Mutagenetix > Incidental Mutation

Incidental Mutation 'R7284:Ezh2'

565859

Institutional Source

Beutler Lab

Gene Symbol

Ezh2

Ensembl Gene

ENSMUSG00000029687

Gene Name

enhancer of zeste 2 polycomb repressive complex 2 subunit

Synonyms

Enx-1, KMT6, Enx1h

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7284 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

47530139-47595341 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 47544519 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Threonine at position 439 (M439T)

Ref Sequence

ENSEMBL: ENSMUSP00000080419 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081721] [ENSMUST00000092648] [ENSMUST00000114616] [ENSMUST00000114618] [ENSMUST00000169889] [ENSMUST00000204798]

AlphaFold

Q61188

PDB Structure

Structural basis of EZH2 recognition by EED [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000081721
AA Change: M439T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000080419
Gene: ENSMUSG00000029687
AA Change: M439T

Domain	Start	End	E-Value	Type
Pfam:EZH2_WD-Binding	39	68	6.1e-18	PFAM
SANT	159	250	9.7e-3	SMART
low complexity region	349	366	N/A	INTRINSIC
low complexity region	385	409	N/A	INTRINSIC
SANT	428	476	6.62e-1	SMART
CXC	555	592	1.05e-1	SMART
SET	612	733	4.15e-38	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000092648
AA Change: M439T

PolyPhen 2 Score 0.067 (Sensitivity: 0.94; Specificity: 0.84)

SMART Domains

Protein: ENSMUSP00000090318
Gene: ENSMUSG00000029687
AA Change: M439T

Domain	Start	End	E-Value	Type
Pfam:EZH2_WD-Binding	39	68	6.9e-20	PFAM
SANT	159	250	9.7e-3	SMART
Blast:SET	272	333	3e-13	BLAST
low complexity region	349	366	N/A	INTRINSIC
low complexity region	385	409	N/A	INTRINSIC
SANT	428	476	6.62e-1	SMART
CXC	513	550	1.05e-1	SMART
SET	570	691	4.15e-38	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000114616
AA Change: M400T

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000110263
Gene: ENSMUSG00000029687
AA Change: M400T

Domain	Start	End	E-Value	Type
Pfam:EZH2_WD-Binding	39	68	2.5e-20	PFAM
SANT	120	211	9.7e-3	SMART
low complexity region	310	327	N/A	INTRINSIC
low complexity region	346	370	N/A	INTRINSIC
SANT	389	437	6.62e-1	SMART
CXC	516	553	1.05e-1	SMART
SET	573	694	4.15e-38	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000114618
AA Change: M435T

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)

SMART Domains

Protein: ENSMUSP00000110265
Gene: ENSMUSG00000029687
AA Change: M435T

Domain	Start	End	E-Value	Type
Pfam:EZH2_WD-Binding	39	68	7.4e-20	PFAM
SANT	150	241	9.7e-3	SMART
low complexity region	345	362	N/A	INTRINSIC
low complexity region	381	405	N/A	INTRINSIC
SANT	424	472	6.62e-1	SMART
CXC	551	588	1.05e-1	SMART
SET	608	729	4.15e-38	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000164006

SMART Domains

Protein: ENSMUSP00000133195
Gene: ENSMUSG00000029687

Domain	Start	End	E-Value	Type
Blast:SET	2	96	1e-16	BLAST
low complexity region	98	122	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000167278

SMART Domains

Protein: ENSMUSP00000128542
Gene: ENSMUSG00000029687

Domain	Start	End	E-Value	Type
Blast:SET	2	43	6e-9	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000169889

SMART Domains

Protein: ENSMUSP00000126481
Gene: ENSMUSG00000029687

Domain	Start	End	E-Value	Type
low complexity region	5	16	N/A	INTRINSIC
Blast:SET	18	150	3e-45	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000204243

Predicted Effect

probably benign
Transcript: ENSMUST00000204798

SMART Domains

Protein: ENSMUSP00000144780
Gene: ENSMUSG00000029687

Domain	Start	End	E-Value	Type
Pfam:EZH2_WD-Binding	39	68	4.4e-16	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

99% (77/78)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Polycomb-group (PcG) family. PcG family members form multimeric protein complexes, which are involved in maintaining the transcriptional repressive state of genes over successive cell generations. This protein associates with the embryonic ectoderm development protein, the VAV1 oncoprotein, and the X-linked nuclear protein. This protein may play a role in the hematopoietic and central nervous systems. Multiple alternatively splcied transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous null mutants die prior to completing gastrulation. A conditional mutant with loss of expression in immune cells survives, but has defects in early B cell development and Igh rearrangement. Conditional loss of maternal protein results in severegrowth retardation of neonates. Conditional loss in oligodendrocytes affects oligodendrocyte maturation and delays subsequent myelinization of axons in the central nervous system by oligodendrocytes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	T	A	1: 105,734,583	H942Q	probably benign	Het
2900092C05Rik	G	T	7: 12,512,678	E34*	probably null	Het
4933421I07Rik	C	T	7: 42,447,980	R30H	probably damaging	Het
AB124611	C	A	9: 21,539,104	Q158K	probably benign	Het
Abcc3	C	T	11: 94,357,047	A1207T	probably benign	Het
Abcc9	A	T	6: 142,682,917	L367Q	probably damaging	Het
Aftph	T	C	11: 20,726,812	K266E	probably benign	Het
Akap9	T	A	5: 3,956,246	D190E	probably damaging	Het
Angel1	G	T	12: 86,720,524	D359E	probably damaging	Het
Ano6	T	C	15: 95,948,303	I474T	probably damaging	Het
Atp2c1	A	T	9: 105,520,809		probably null	Het
Best1	T	C	19: 9,986,373		probably null	Het
Bhlha9	A	G	11: 76,672,666	S40G	probably benign	Het
Cabin1	G	A	10: 75,694,834	R178C		Het
Ccnb1ip1	A	G	14: 50,792,279	Y109H	probably damaging	Het
Col14a1	T	C	15: 55,518,319	S1763P	probably damaging	Het
Dars	T	C	1: 128,372,267	T327A	probably benign	Het
Dhx8	T	C	11: 101,754,822	Y889H	probably damaging	Het
Dlg4	T	A	11: 70,042,082	Y523*	probably null	Het
Dnah10	A	T	5: 124,832,598	D4484V	probably benign	Het
Dnah9	A	T	11: 65,990,476	M2591K	probably damaging	Het
Dock2	T	C	11: 34,230,672	E1715G	probably benign	Het
Dym	A	G	18: 75,119,171	Y336C	possibly damaging	Het
Folr1	T	G	7: 101,859,470	N83H	possibly damaging	Het
Ganab	T	C	19: 8,912,540	L656P	probably damaging	Het
Gmnc	T	C	16: 26,960,792	H161R	probably benign	Het
Gria4	A	G	9: 4,472,017	Y491H	probably damaging	Het
Heatr3	T	A	8: 88,156,774	C412S	possibly damaging	Het
Hmgcr	A	C	13: 96,652,665	V716G	probably damaging	Het
Igsf9	A	G	1: 172,496,912	D799G	probably damaging	Het
Ikbkb	T	C	8: 22,668,960	T501A	probably benign	Het
Kbtbd3	C	T	9: 4,330,690	R355*	probably null	Het
Kcna7	T	A	7: 45,409,228	I313N	probably damaging	Het
Kirrel	A	C	3: 87,083,387	D709E	probably benign	Het
Klb	T	A	5: 65,383,478	S971R	probably benign	Het
Krtap4-13	A	T	11: 99,809,412	C140*	probably null	Het
Lacc1	A	T	14: 77,030,869	L334Q	probably damaging	Het
Map6d1	T	A	16: 20,241,025	R97*	probably null	Het
Mgat5b	T	C	11: 116,944,920	S129P	probably damaging	Het
Mmp1a	TG	TGG	9: 7,465,083		probably null	Het
Myh9	G	A	15: 77,787,596	R432C	probably damaging	Het
Ncf4	A	G	15: 78,260,702	T236A	probably benign	Het
Neb	T	C	2: 52,258,792	D2581G	probably damaging	Het
Nid1	T	A	13: 13,489,090	M778K	probably benign	Het
Npas2	A	G	1: 39,324,467	D209G	probably benign	Het
Nploc4	C	T	11: 120,416,370	V181I	possibly damaging	Het
Nrcam	A	T	12: 44,564,034	I506F	probably damaging	Het
Olfr197	A	G	16: 59,185,968	*172Q	probably null	Het
Olfr692	T	A	7: 105,368,545	M73K	probably damaging	Het
Olfr803	T	C	10: 129,691,351	N230S	probably benign	Het
Pask	T	A	1: 93,320,669	Q970L	probably benign	Het
Pfkfb4	T	C	9: 109,011,240	I308T	possibly damaging	Het
Pla2g4d	A	T	2: 120,284,136	L38Q	probably damaging	Het
Pld1	A	G	3: 28,131,733	T1036A	possibly damaging	Het
Pom121l2	A	G	13: 21,982,605	T349A	probably damaging	Het
Ppp1r13b	A	G	12: 111,834,966	I551T	possibly damaging	Het
Prps1l1	A	G	12: 34,985,318	N144S	possibly damaging	Het
Prss56	A	G	1: 87,185,401	N179S	probably null	Het
Prune2	T	C	19: 17,119,886	L918P	probably damaging	Het
Ptprz1	C	T	6: 23,000,098	T729I	probably damaging	Het
Rrp7a	T	C	15: 83,121,870	T60A	probably damaging	Het
Snx27	A	G	3: 94,524,191	Y299H	probably damaging	Het
Spaca3	G	T	11: 80,864,021	R96L	possibly damaging	Het
Stat1	A	G	1: 52,148,922	N495S	probably benign	Het
Tas2r130	T	C	6: 131,630,307	N175S	probably benign	Het
Tcaf2	A	G	6: 42,629,538	L494P	probably damaging	Het
Tdrd12	C	A	7: 35,480,136		probably null	Het
Thbs1	A	G	2: 118,119,356	N604S	probably damaging	Het
Togaram1	T	C	12: 65,008,680	F1482L	probably benign	Het
Trhr2	A	T	8: 122,360,375	S109T	probably damaging	Het
Trpc3	A	T	3: 36,624,413	M841K	probably damaging	Het
Tubgcp5	C	T	7: 55,823,567	R798C	probably benign	Het
Xirp2	T	A	2: 67,516,829	M3138K	probably benign	Het
Zdhhc4	G	A	5: 143,321,891	T125I	probably benign	Het
Zfp239	T	A	6: 117,871,755	C151*	probably null	Het
Zfp473	C	T	7: 44,733,203	E569K	not run	Het
Zzef1	T	A	11: 72,886,690	D1782E	probably damaging	Het

Other mutations in Ezh2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01582:Ezh2	APN	6	47556055	nonsense	probably null
IGL01932:Ezh2	APN	6	47532048	missense	probably damaging	0.99
IGL02019:Ezh2	APN	6	47551901	splice site	probably null
IGL02748:Ezh2	APN	6	47558239	missense	probably damaging	1.00
IGL02749:Ezh2	APN	6	47533764	missense	probably damaging	0.99
IGL03171:Ezh2	APN	6	47540781	nonsense	probably null
Peezy	UTSW	6	47533758	nonsense	probably null
R0417:Ezh2	UTSW	6	47551726	missense	probably benign	0.00
R1256:Ezh2	UTSW	6	47541855	nonsense	probably null
R1587:Ezh2	UTSW	6	47552490	critical splice acceptor site	probably null
R1631:Ezh2	UTSW	6	47577658	start codon destroyed	probably null	0.01
R1736:Ezh2	UTSW	6	47576660	missense	probably damaging	1.00
R1775:Ezh2	UTSW	6	47576660	missense	probably damaging	1.00
R2076:Ezh2	UTSW	6	47576633	nonsense	probably null
R2311:Ezh2	UTSW	6	47558260	missense	probably damaging	1.00
R3751:Ezh2	UTSW	6	47556064	missense	possibly damaging	0.94
R4016:Ezh2	UTSW	6	47544582	missense	probably benign
R4119:Ezh2	UTSW	6	47544548	missense	probably benign	0.00
R4214:Ezh2	UTSW	6	47533814	missense	probably damaging	1.00
R4770:Ezh2	UTSW	6	47540696	missense	probably damaging	1.00
R5133:Ezh2	UTSW	6	47540750	missense	probably damaging	1.00
R5137:Ezh2	UTSW	6	47532080	splice site	probably null
R5199:Ezh2	UTSW	6	47551725	missense	probably benign	0.01
R5343:Ezh2	UTSW	6	47576615	missense	probably damaging	1.00
R5584:Ezh2	UTSW	6	47532016	missense	probably damaging	1.00
R5942:Ezh2	UTSW	6	47577582	missense	possibly damaging	0.94
R6057:Ezh2	UTSW	6	47552423	missense	probably damaging	1.00
R7247:Ezh2	UTSW	6	47533774	missense	probably damaging	1.00
R7365:Ezh2	UTSW	6	47533758	nonsense	probably null
R7382:Ezh2	UTSW	6	47551836	missense	possibly damaging	0.55
R7718:Ezh2	UTSW	6	47554191	missense	probably benign
R7910:Ezh2	UTSW	6	47556143	missense	probably damaging	0.96
R8206:Ezh2	UTSW	6	47532900	critical splice donor site	probably null
R8428:Ezh2	UTSW	6	47545811	nonsense	probably null
R8746:Ezh2	UTSW	6	47576600	missense	probably damaging	0.99
R8836:Ezh2	UTSW	6	47554262	missense	probably benign
R8925:Ezh2	UTSW	6	47533779	missense	possibly damaging	0.89
R8927:Ezh2	UTSW	6	47533779	missense	possibly damaging	0.89
R9039:Ezh2	UTSW	6	47551737	missense	possibly damaging	0.80
R9171:Ezh2	UTSW	6	47554200	missense	probably benign
R9642:Ezh2	UTSW	6	47544519	missense	probably benign	0.00
R9716:Ezh2	UTSW	6	47554207	missense	possibly damaging	0.95
R9774:Ezh2	UTSW	6	47542381	missense	probably benign	0.00
X0021:Ezh2	UTSW	6	47554169	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- TCTGGCCAAAGTTCACTCTATGTAC -3'
(R):5'- GTCAGTATACACACATATGCCATTG -3'

Sequencing Primer
(F):5'- GAGGAGGGGAAATTAATTCTTTTCAG -3'
(R):5'- GTCCTCATGCTTGCATGATAAGAGC -3'

Posted On

2019-06-26