Incidental Mutation 'R7284:Kcna7'
ID565866
Institutional Source Beutler Lab
Gene Symbol Kcna7
Ensembl Gene ENSMUSG00000038201
Gene Namepotassium voltage-gated channel, shaker-related subfamily, member 7
SynonymsKv1.7
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.071) question?
Stock #R7284 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location45405653-45409763 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 45409228 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 313 (I313N)
Ref Sequence ENSEMBL: ENSMUSP00000103403 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058879] [ENSMUST00000107774] [ENSMUST00000210347]
Predicted Effect probably benign
Transcript: ENSMUST00000058879
SMART Domains Protein: ENSMUSP00000057916
Gene: ENSMUSG00000074121

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 50 74 N/A INTRINSIC
NGF 88 201 8.06e-83 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000107774
AA Change: I313N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103403
Gene: ENSMUSG00000038201
AA Change: I313N

DomainStartEndE-ValueType
BTB 45 145 1.77e-7 SMART
Pfam:Ion_trans 174 438 1.7e-52 PFAM
Pfam:Ion_trans_2 346 432 1.7e-13 PFAM
low complexity region 471 480 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000210347
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Potassium channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. Four sequence-related potassium channel genes - shaker, shaw, shab, and shal - have been identified in Drosophila, and each has been shown to have human homolog(s). This gene encodes a member of the potassium channel, voltage-gated, shaker-related subfamily. This member contains six membrane-spanning domains with a shaker-type repeat in the fourth segment. The gene is expressed preferentially in skeletal muscle, heart and kidney. It is a candidate gene for inherited cardiac disorders. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,734,583 H942Q probably benign Het
2900092C05Rik G T 7: 12,512,678 E34* probably null Het
4933421I07Rik C T 7: 42,447,980 R30H probably damaging Het
AB124611 C A 9: 21,539,104 Q158K probably benign Het
Abcc3 C T 11: 94,357,047 A1207T probably benign Het
Abcc9 A T 6: 142,682,917 L367Q probably damaging Het
Aftph T C 11: 20,726,812 K266E probably benign Het
Akap9 T A 5: 3,956,246 D190E probably damaging Het
Angel1 G T 12: 86,720,524 D359E probably damaging Het
Ano6 T C 15: 95,948,303 I474T probably damaging Het
Atp2c1 A T 9: 105,520,809 probably null Het
Best1 T C 19: 9,986,373 probably null Het
Bhlha9 A G 11: 76,672,666 S40G probably benign Het
Cabin1 G A 10: 75,694,834 R178C Het
Ccnb1ip1 A G 14: 50,792,279 Y109H probably damaging Het
Col14a1 T C 15: 55,518,319 S1763P probably damaging Het
Dars T C 1: 128,372,267 T327A probably benign Het
Dhx8 T C 11: 101,754,822 Y889H probably damaging Het
Dlg4 T A 11: 70,042,082 Y523* probably null Het
Dnah10 A T 5: 124,832,598 D4484V probably benign Het
Dnah9 A T 11: 65,990,476 M2591K probably damaging Het
Dock2 T C 11: 34,230,672 E1715G probably benign Het
Dym A G 18: 75,119,171 Y336C possibly damaging Het
Ezh2 A G 6: 47,544,519 M439T probably benign Het
Folr1 T G 7: 101,859,470 N83H possibly damaging Het
Ganab T C 19: 8,912,540 L656P probably damaging Het
Gmnc T C 16: 26,960,792 H161R probably benign Het
Gria4 A G 9: 4,472,017 Y491H probably damaging Het
Heatr3 T A 8: 88,156,774 C412S possibly damaging Het
Hmgcr A C 13: 96,652,665 V716G probably damaging Het
Igsf9 A G 1: 172,496,912 D799G probably damaging Het
Ikbkb T C 8: 22,668,960 T501A probably benign Het
Kbtbd3 C T 9: 4,330,690 R355* probably null Het
Kirrel A C 3: 87,083,387 D709E probably benign Het
Klb T A 5: 65,383,478 S971R probably benign Het
Krtap4-13 A T 11: 99,809,412 C140* probably null Het
Lacc1 A T 14: 77,030,869 L334Q probably damaging Het
Map6d1 T A 16: 20,241,025 R97* probably null Het
Mgat5b T C 11: 116,944,920 S129P probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Myh9 G A 15: 77,787,596 R432C probably damaging Het
Ncf4 A G 15: 78,260,702 T236A probably benign Het
Neb T C 2: 52,258,792 D2581G probably damaging Het
Nid1 T A 13: 13,489,090 M778K probably benign Het
Npas2 A G 1: 39,324,467 D209G probably benign Het
Nploc4 C T 11: 120,416,370 V181I possibly damaging Het
Nrcam A T 12: 44,564,034 I506F probably damaging Het
Olfr197 A G 16: 59,185,968 *172Q probably null Het
Olfr692 T A 7: 105,368,545 M73K probably damaging Het
Olfr803 T C 10: 129,691,351 N230S probably benign Het
Pask T A 1: 93,320,669 Q970L probably benign Het
Pfkfb4 T C 9: 109,011,240 I308T possibly damaging Het
Pla2g4d A T 2: 120,284,136 L38Q probably damaging Het
Pld1 A G 3: 28,131,733 T1036A possibly damaging Het
Pom121l2 A G 13: 21,982,605 T349A probably damaging Het
Ppp1r13b A G 12: 111,834,966 I551T possibly damaging Het
Prps1l1 A G 12: 34,985,318 N144S possibly damaging Het
Prss56 A G 1: 87,185,401 N179S probably null Het
Prune2 T C 19: 17,119,886 L918P probably damaging Het
Ptprz1 C T 6: 23,000,098 T729I probably damaging Het
Rrp7a T C 15: 83,121,870 T60A probably damaging Het
Snx27 A G 3: 94,524,191 Y299H probably damaging Het
Spaca3 G T 11: 80,864,021 R96L possibly damaging Het
Stat1 A G 1: 52,148,922 N495S probably benign Het
Tas2r130 T C 6: 131,630,307 N175S probably benign Het
Tcaf2 A G 6: 42,629,538 L494P probably damaging Het
Tdrd12 C A 7: 35,480,136 probably null Het
Thbs1 A G 2: 118,119,356 N604S probably damaging Het
Togaram1 T C 12: 65,008,680 F1482L probably benign Het
Trhr2 A T 8: 122,360,375 S109T probably damaging Het
Trpc3 A T 3: 36,624,413 M841K probably damaging Het
Tubgcp5 C T 7: 55,823,567 R798C probably benign Het
Xirp2 T A 2: 67,516,829 M3138K probably benign Het
Zdhhc4 G A 5: 143,321,891 T125I probably benign Het
Zfp239 T A 6: 117,871,755 C151* probably null Het
Zfp473 C T 7: 44,733,203 E569K not run Het
Zzef1 T A 11: 72,886,690 D1782E probably damaging Het
Other mutations in Kcna7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01534:Kcna7 APN 7 45406511 missense probably damaging 1.00
IGL02477:Kcna7 APN 7 45409623 missense probably benign 0.01
R0373:Kcna7 UTSW 7 45409444 missense probably damaging 1.00
R0624:Kcna7 UTSW 7 45409690 missense probably null 1.00
R0850:Kcna7 UTSW 7 45409431 missense probably damaging 0.99
R1721:Kcna7 UTSW 7 45406921 missense possibly damaging 0.95
R1727:Kcna7 UTSW 7 45409506 missense possibly damaging 0.94
R3040:Kcna7 UTSW 7 45406788 frame shift probably null
R3755:Kcna7 UTSW 7 45408945 missense probably benign 0.00
R5024:Kcna7 UTSW 7 45406591 missense probably damaging 1.00
R5054:Kcna7 UTSW 7 45406591 missense probably damaging 1.00
R5055:Kcna7 UTSW 7 45406591 missense probably damaging 1.00
R5056:Kcna7 UTSW 7 45406591 missense probably damaging 1.00
R5549:Kcna7 UTSW 7 45406639 missense probably damaging 0.98
R6669:Kcna7 UTSW 7 45409564 missense probably damaging 1.00
R7309:Kcna7 UTSW 7 45409255 missense probably damaging 1.00
R8028:Kcna7 UTSW 7 45409523 nonsense probably null
R8326:Kcna7 UTSW 7 45409341 missense probably damaging 1.00
Z1088:Kcna7 UTSW 7 45406959 missense probably benign 0.21
Z1088:Kcna7 UTSW 7 45409105 missense probably damaging 1.00
Z1177:Kcna7 UTSW 7 45409183 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGGAGACCCTGTGTATCTGC -3'
(R):5'- TCCGGGATGCTGGTGAAATG -3'

Sequencing Primer
(F):5'- AGACCCTGTGTATCTGCTGGTTC -3'
(R):5'- ATGCTGGTGAAATGGGTGTCC -3'
Posted On2019-06-26