Incidental Mutation 'R7284:Tubgcp5'
ID 565867
Institutional Source Beutler Lab
Gene Symbol Tubgcp5
Ensembl Gene ENSMUSG00000033790
Gene Name tubulin, gamma complex component 5
Synonyms GCP5, B130010C12Rik
MMRRC Submission 045392-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.967) question?
Stock # R7284 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 55443873-55481207 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 55473315 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Cysteine at position 798 (R798C)
Ref Sequence ENSEMBL: ENSMUSP00000146111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032627] [ENSMUST00000205796] [ENSMUST00000206133] [ENSMUST00000206191]
AlphaFold Q8BKN5
Predicted Effect probably benign
Transcript: ENSMUST00000032627
AA Change: R861C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000032627
Gene: ENSMUSG00000033790
AA Change: R861C

DomainStartEndE-ValueType
low complexity region 109 124 N/A INTRINSIC
Pfam:Spc97_Spc98 273 942 1.2e-126 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205311
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205718
Predicted Effect probably benign
Transcript: ENSMUST00000205796
AA Change: R798C

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000206133
Predicted Effect probably benign
Transcript: ENSMUST00000206191
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206789
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik G T 7: 12,246,605 (GRCm39) E34* probably null Het
4933421I07Rik C T 7: 42,097,404 (GRCm39) R30H probably damaging Het
AB124611 C A 9: 21,450,400 (GRCm39) Q158K probably benign Het
Abcc3 C T 11: 94,247,873 (GRCm39) A1207T probably benign Het
Abcc9 A T 6: 142,628,643 (GRCm39) L367Q probably damaging Het
Aftph T C 11: 20,676,812 (GRCm39) K266E probably benign Het
Akap9 T A 5: 4,006,246 (GRCm39) D190E probably damaging Het
Angel1 G T 12: 86,767,298 (GRCm39) D359E probably damaging Het
Ano6 T C 15: 95,846,184 (GRCm39) I474T probably damaging Het
Atp2c1 A T 9: 105,398,008 (GRCm39) probably null Het
Best1 T C 19: 9,963,737 (GRCm39) probably null Het
Bhlha9 A G 11: 76,563,492 (GRCm39) S40G probably benign Het
Cabin1 G A 10: 75,530,668 (GRCm39) R178C Het
Ccnb1ip1 A G 14: 51,029,736 (GRCm39) Y109H probably damaging Het
Col14a1 T C 15: 55,381,715 (GRCm39) S1763P probably damaging Het
Dars1 T C 1: 128,300,004 (GRCm39) T327A probably benign Het
Dhx8 T C 11: 101,645,648 (GRCm39) Y889H probably damaging Het
Dlg4 T A 11: 69,932,908 (GRCm39) Y523* probably null Het
Dnah10 A T 5: 124,909,662 (GRCm39) D4484V probably benign Het
Dnah9 A T 11: 65,881,302 (GRCm39) M2591K probably damaging Het
Dock2 T C 11: 34,180,672 (GRCm39) E1715G probably benign Het
Dym A G 18: 75,252,242 (GRCm39) Y336C possibly damaging Het
Ezh2 A G 6: 47,521,453 (GRCm39) M439T probably benign Het
Folr1 T G 7: 101,508,677 (GRCm39) N83H possibly damaging Het
Ganab T C 19: 8,889,904 (GRCm39) L656P probably damaging Het
Gmnc T C 16: 26,779,542 (GRCm39) H161R probably benign Het
Gria4 A G 9: 4,472,017 (GRCm39) Y491H probably damaging Het
Heatr3 T A 8: 88,883,402 (GRCm39) C412S possibly damaging Het
Hmgcr A C 13: 96,789,173 (GRCm39) V716G probably damaging Het
Igsf9 A G 1: 172,324,479 (GRCm39) D799G probably damaging Het
Ikbkb T C 8: 23,158,976 (GRCm39) T501A probably benign Het
Kbtbd3 C T 9: 4,330,690 (GRCm39) R355* probably null Het
Kcna7 T A 7: 45,058,652 (GRCm39) I313N probably damaging Het
Kirrel1 A C 3: 86,990,694 (GRCm39) D709E probably benign Het
Klb T A 5: 65,540,821 (GRCm39) S971R probably benign Het
Krtap4-13 A T 11: 99,700,238 (GRCm39) C140* probably null Het
Lacc1 A T 14: 77,268,309 (GRCm39) L334Q probably damaging Het
Map6d1 T A 16: 20,059,775 (GRCm39) R97* probably null Het
Mgat5b T C 11: 116,835,746 (GRCm39) S129P probably damaging Het
Mmp1a TG TGG 9: 7,465,083 (GRCm38) probably null Het
Myh9 G A 15: 77,671,796 (GRCm39) R432C probably damaging Het
Ncf4 A G 15: 78,144,902 (GRCm39) T236A probably benign Het
Neb T C 2: 52,148,804 (GRCm39) D2581G probably damaging Het
Nid1 T A 13: 13,663,675 (GRCm39) M778K probably benign Het
Npas2 A G 1: 39,363,548 (GRCm39) D209G probably benign Het
Nploc4 C T 11: 120,307,196 (GRCm39) V181I possibly damaging Het
Nrcam A T 12: 44,610,817 (GRCm39) I506F probably damaging Het
Or52w1 T A 7: 105,017,752 (GRCm39) M73K probably damaging Het
Or5h27 A G 16: 59,006,331 (GRCm39) *172Q probably null Het
Or6c3b T C 10: 129,527,220 (GRCm39) N230S probably benign Het
Pask T A 1: 93,248,391 (GRCm39) Q970L probably benign Het
Pfkfb4 T C 9: 108,840,308 (GRCm39) I308T possibly damaging Het
Pla2g4d A T 2: 120,114,617 (GRCm39) L38Q probably damaging Het
Pld1 A G 3: 28,185,882 (GRCm39) T1036A possibly damaging Het
Pom121l2 A G 13: 22,166,775 (GRCm39) T349A probably damaging Het
Ppp1r13b A G 12: 111,801,400 (GRCm39) I551T possibly damaging Het
Prps1l1 A G 12: 35,035,317 (GRCm39) N144S possibly damaging Het
Prss56 A G 1: 87,113,123 (GRCm39) N179S probably null Het
Prune2 T C 19: 17,097,250 (GRCm39) L918P probably damaging Het
Ptprz1 C T 6: 23,000,097 (GRCm39) T729I probably damaging Het
Relch T A 1: 105,662,308 (GRCm39) H942Q probably benign Het
Rrp7a T C 15: 83,006,071 (GRCm39) T60A probably damaging Het
Snx27 A G 3: 94,431,498 (GRCm39) Y299H probably damaging Het
Spaca3 G T 11: 80,754,847 (GRCm39) R96L possibly damaging Het
Stat1 A G 1: 52,188,081 (GRCm39) N495S probably benign Het
Tas2r130 T C 6: 131,607,270 (GRCm39) N175S probably benign Het
Tcaf2 A G 6: 42,606,472 (GRCm39) L494P probably damaging Het
Tdrd12 C A 7: 35,179,561 (GRCm39) probably null Het
Thbs1 A G 2: 117,949,837 (GRCm39) N604S probably damaging Het
Togaram1 T C 12: 65,055,454 (GRCm39) F1482L probably benign Het
Trhr2 A T 8: 123,087,114 (GRCm39) S109T probably damaging Het
Trpc3 A T 3: 36,678,562 (GRCm39) M841K probably damaging Het
Xirp2 T A 2: 67,347,173 (GRCm39) M3138K probably benign Het
Zdhhc4 G A 5: 143,307,646 (GRCm39) T125I probably benign Het
Zfp239 T A 6: 117,848,716 (GRCm39) C151* probably null Het
Zfp473 C T 7: 44,382,627 (GRCm39) E569K not run Het
Zzef1 T A 11: 72,777,516 (GRCm39) D1782E probably damaging Het
Other mutations in Tubgcp5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Tubgcp5 APN 7 55,456,343 (GRCm39) missense possibly damaging 0.91
IGL01291:Tubgcp5 APN 7 55,458,277 (GRCm39) missense possibly damaging 0.83
IGL01343:Tubgcp5 APN 7 55,445,779 (GRCm39) splice site probably benign
IGL01597:Tubgcp5 APN 7 55,456,580 (GRCm39) splice site probably benign
IGL01688:Tubgcp5 APN 7 55,464,766 (GRCm39) missense possibly damaging 0.92
IGL01843:Tubgcp5 APN 7 55,449,221 (GRCm39) missense probably benign 0.02
IGL01950:Tubgcp5 APN 7 55,455,836 (GRCm39) missense possibly damaging 0.93
IGL01957:Tubgcp5 APN 7 55,468,505 (GRCm39) missense probably damaging 1.00
IGL02902:Tubgcp5 APN 7 55,456,355 (GRCm39) nonsense probably null
IGL03105:Tubgcp5 APN 7 55,475,329 (GRCm39) missense probably damaging 1.00
ANU05:Tubgcp5 UTSW 7 55,458,277 (GRCm39) missense possibly damaging 0.83
R0078:Tubgcp5 UTSW 7 55,468,643 (GRCm39) missense probably damaging 1.00
R0322:Tubgcp5 UTSW 7 55,464,726 (GRCm39) missense probably damaging 0.98
R0362:Tubgcp5 UTSW 7 55,450,432 (GRCm39) missense probably damaging 1.00
R0449:Tubgcp5 UTSW 7 55,473,315 (GRCm39) missense probably benign
R0488:Tubgcp5 UTSW 7 55,479,086 (GRCm39) missense probably damaging 0.96
R0853:Tubgcp5 UTSW 7 55,464,599 (GRCm39) splice site probably benign
R0885:Tubgcp5 UTSW 7 55,455,803 (GRCm39) nonsense probably null
R1483:Tubgcp5 UTSW 7 55,475,455 (GRCm39) critical splice donor site probably null
R1746:Tubgcp5 UTSW 7 55,458,285 (GRCm39) missense probably benign 0.05
R1766:Tubgcp5 UTSW 7 55,464,768 (GRCm39) missense probably benign 0.15
R2148:Tubgcp5 UTSW 7 55,449,259 (GRCm39) missense probably damaging 1.00
R2229:Tubgcp5 UTSW 7 55,480,629 (GRCm39) missense probably damaging 1.00
R3766:Tubgcp5 UTSW 7 55,480,614 (GRCm39) missense probably damaging 0.98
R4154:Tubgcp5 UTSW 7 55,455,077 (GRCm39) missense probably benign 0.01
R4838:Tubgcp5 UTSW 7 55,443,933 (GRCm39) unclassified probably benign
R4948:Tubgcp5 UTSW 7 55,455,871 (GRCm39) missense probably benign 0.00
R5110:Tubgcp5 UTSW 7 55,458,385 (GRCm39) missense probably damaging 0.96
R5347:Tubgcp5 UTSW 7 55,473,433 (GRCm39) missense probably damaging 1.00
R5417:Tubgcp5 UTSW 7 55,475,409 (GRCm39) missense possibly damaging 0.90
R5574:Tubgcp5 UTSW 7 55,455,077 (GRCm39) missense probably benign 0.01
R5758:Tubgcp5 UTSW 7 55,468,643 (GRCm39) missense probably damaging 1.00
R5957:Tubgcp5 UTSW 7 55,464,710 (GRCm39) missense probably benign 0.03
R6014:Tubgcp5 UTSW 7 55,473,357 (GRCm39) missense probably benign
R6141:Tubgcp5 UTSW 7 55,456,526 (GRCm39) missense probably benign 0.30
R6289:Tubgcp5 UTSW 7 55,445,671 (GRCm39) missense probably benign 0.05
R6511:Tubgcp5 UTSW 7 55,467,140 (GRCm39) nonsense probably null
R6563:Tubgcp5 UTSW 7 55,475,409 (GRCm39) missense possibly damaging 0.90
R6574:Tubgcp5 UTSW 7 55,473,331 (GRCm39) missense probably benign
R6596:Tubgcp5 UTSW 7 55,456,382 (GRCm39) missense probably benign 0.38
R7016:Tubgcp5 UTSW 7 55,443,977 (GRCm39) missense possibly damaging 0.76
R7038:Tubgcp5 UTSW 7 55,455,114 (GRCm39) missense probably damaging 0.99
R7075:Tubgcp5 UTSW 7 55,479,155 (GRCm39) missense probably benign 0.04
R7083:Tubgcp5 UTSW 7 55,450,443 (GRCm39) nonsense probably null
R7213:Tubgcp5 UTSW 7 55,455,860 (GRCm39) missense probably damaging 0.97
R7600:Tubgcp5 UTSW 7 55,458,261 (GRCm39) missense probably benign
R7813:Tubgcp5 UTSW 7 55,450,444 (GRCm39) missense possibly damaging 0.49
R7920:Tubgcp5 UTSW 7 55,466,310 (GRCm39) missense probably benign 0.00
R7948:Tubgcp5 UTSW 7 55,443,996 (GRCm39) missense probably benign 0.01
R8438:Tubgcp5 UTSW 7 55,454,363 (GRCm39) missense possibly damaging 0.67
R8499:Tubgcp5 UTSW 7 55,454,363 (GRCm39) missense possibly damaging 0.67
R9087:Tubgcp5 UTSW 7 55,467,106 (GRCm39) missense probably damaging 1.00
R9211:Tubgcp5 UTSW 7 55,456,331 (GRCm39) missense probably benign 0.05
R9269:Tubgcp5 UTSW 7 55,445,693 (GRCm39) missense possibly damaging 0.94
R9329:Tubgcp5 UTSW 7 55,479,181 (GRCm39) critical splice donor site probably null
R9355:Tubgcp5 UTSW 7 55,467,177 (GRCm39) critical splice donor site probably null
R9498:Tubgcp5 UTSW 7 55,463,233 (GRCm39) missense possibly damaging 0.46
R9687:Tubgcp5 UTSW 7 55,475,327 (GRCm39) critical splice acceptor site probably null
Z1088:Tubgcp5 UTSW 7 55,464,849 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGTTTAGTGAAGGTCTGACCG -3'
(R):5'- GTCTCTGAACTACCACTTACACAAG -3'

Sequencing Primer
(F):5'- TCCCCAGTGCTAGGATTAACAGATG -3'
(R):5'- ACTTACACAAGACAAAAGAACAGAG -3'
Posted On 2019-06-26