Incidental Mutation 'R7284:Or52w1'
ID 565869
Institutional Source Beutler Lab
Gene Symbol Or52w1
Ensembl Gene ENSMUSG00000073906
Gene Name olfactory receptor family 52 subfamily W member 1
Synonyms MOR36-1, GA_x6K02T2PBJ9-7994144-7995106, Olfr692
MMRRC Submission 045392-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.166) question?
Stock # R7284 (G1)
Quality Score 225.009
Status Validated
Chromosome 7
Chromosomal Location 105017535-105018524 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 105017752 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 73 (M73K)
Ref Sequence ENSEMBL: ENSMUSP00000151295 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000098152] [ENSMUST00000179474] [ENSMUST00000217827]
AlphaFold Q8VF03
Predicted Effect probably damaging
Transcript: ENSMUST00000098152
AA Change: M64K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000095755
Gene: ENSMUSG00000073906
AA Change: M64K

DomainStartEndE-ValueType
Pfam:7tm_4 45 325 1.3e-90 PFAM
Pfam:7TM_GPCR_Srsx 49 233 1.3e-7 PFAM
Pfam:7tm_1 55 307 3.9e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000179474
SMART Domains Protein: ENSMUSP00000137163
Gene: ENSMUSG00000044465

DomainStartEndE-ValueType
Pfam:RAI16-like 96 426 4.2e-98 PFAM
low complexity region 496 515 N/A INTRINSIC
low complexity region 541 558 N/A INTRINSIC
low complexity region 711 724 N/A INTRINSIC
low complexity region 732 744 N/A INTRINSIC
low complexity region 905 920 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000217827
AA Change: M73K

PolyPhen 2 Score 0.975 (Sensitivity: 0.76; Specificity: 0.96)
Meta Mutation Damage Score 0.3812 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik G T 7: 12,246,605 (GRCm39) E34* probably null Het
4933421I07Rik C T 7: 42,097,404 (GRCm39) R30H probably damaging Het
AB124611 C A 9: 21,450,400 (GRCm39) Q158K probably benign Het
Abcc3 C T 11: 94,247,873 (GRCm39) A1207T probably benign Het
Abcc9 A T 6: 142,628,643 (GRCm39) L367Q probably damaging Het
Aftph T C 11: 20,676,812 (GRCm39) K266E probably benign Het
Akap9 T A 5: 4,006,246 (GRCm39) D190E probably damaging Het
Angel1 G T 12: 86,767,298 (GRCm39) D359E probably damaging Het
Ano6 T C 15: 95,846,184 (GRCm39) I474T probably damaging Het
Atp2c1 A T 9: 105,398,008 (GRCm39) probably null Het
Best1 T C 19: 9,963,737 (GRCm39) probably null Het
Bhlha9 A G 11: 76,563,492 (GRCm39) S40G probably benign Het
Cabin1 G A 10: 75,530,668 (GRCm39) R178C Het
Ccnb1ip1 A G 14: 51,029,736 (GRCm39) Y109H probably damaging Het
Col14a1 T C 15: 55,381,715 (GRCm39) S1763P probably damaging Het
Dars1 T C 1: 128,300,004 (GRCm39) T327A probably benign Het
Dhx8 T C 11: 101,645,648 (GRCm39) Y889H probably damaging Het
Dlg4 T A 11: 69,932,908 (GRCm39) Y523* probably null Het
Dnah10 A T 5: 124,909,662 (GRCm39) D4484V probably benign Het
Dnah9 A T 11: 65,881,302 (GRCm39) M2591K probably damaging Het
Dock2 T C 11: 34,180,672 (GRCm39) E1715G probably benign Het
Dym A G 18: 75,252,242 (GRCm39) Y336C possibly damaging Het
Ezh2 A G 6: 47,521,453 (GRCm39) M439T probably benign Het
Folr1 T G 7: 101,508,677 (GRCm39) N83H possibly damaging Het
Ganab T C 19: 8,889,904 (GRCm39) L656P probably damaging Het
Gmnc T C 16: 26,779,542 (GRCm39) H161R probably benign Het
Gria4 A G 9: 4,472,017 (GRCm39) Y491H probably damaging Het
Heatr3 T A 8: 88,883,402 (GRCm39) C412S possibly damaging Het
Hmgcr A C 13: 96,789,173 (GRCm39) V716G probably damaging Het
Igsf9 A G 1: 172,324,479 (GRCm39) D799G probably damaging Het
Ikbkb T C 8: 23,158,976 (GRCm39) T501A probably benign Het
Kbtbd3 C T 9: 4,330,690 (GRCm39) R355* probably null Het
Kcna7 T A 7: 45,058,652 (GRCm39) I313N probably damaging Het
Kirrel1 A C 3: 86,990,694 (GRCm39) D709E probably benign Het
Klb T A 5: 65,540,821 (GRCm39) S971R probably benign Het
Krtap4-13 A T 11: 99,700,238 (GRCm39) C140* probably null Het
Lacc1 A T 14: 77,268,309 (GRCm39) L334Q probably damaging Het
Map6d1 T A 16: 20,059,775 (GRCm39) R97* probably null Het
Mgat5b T C 11: 116,835,746 (GRCm39) S129P probably damaging Het
Mmp1a TG TGG 9: 7,465,083 (GRCm38) probably null Het
Myh9 G A 15: 77,671,796 (GRCm39) R432C probably damaging Het
Ncf4 A G 15: 78,144,902 (GRCm39) T236A probably benign Het
Neb T C 2: 52,148,804 (GRCm39) D2581G probably damaging Het
Nid1 T A 13: 13,663,675 (GRCm39) M778K probably benign Het
Npas2 A G 1: 39,363,548 (GRCm39) D209G probably benign Het
Nploc4 C T 11: 120,307,196 (GRCm39) V181I possibly damaging Het
Nrcam A T 12: 44,610,817 (GRCm39) I506F probably damaging Het
Or5h27 A G 16: 59,006,331 (GRCm39) *172Q probably null Het
Or6c3b T C 10: 129,527,220 (GRCm39) N230S probably benign Het
Pask T A 1: 93,248,391 (GRCm39) Q970L probably benign Het
Pfkfb4 T C 9: 108,840,308 (GRCm39) I308T possibly damaging Het
Pla2g4d A T 2: 120,114,617 (GRCm39) L38Q probably damaging Het
Pld1 A G 3: 28,185,882 (GRCm39) T1036A possibly damaging Het
Pom121l2 A G 13: 22,166,775 (GRCm39) T349A probably damaging Het
Ppp1r13b A G 12: 111,801,400 (GRCm39) I551T possibly damaging Het
Prps1l1 A G 12: 35,035,317 (GRCm39) N144S possibly damaging Het
Prss56 A G 1: 87,113,123 (GRCm39) N179S probably null Het
Prune2 T C 19: 17,097,250 (GRCm39) L918P probably damaging Het
Ptprz1 C T 6: 23,000,097 (GRCm39) T729I probably damaging Het
Relch T A 1: 105,662,308 (GRCm39) H942Q probably benign Het
Rrp7a T C 15: 83,006,071 (GRCm39) T60A probably damaging Het
Snx27 A G 3: 94,431,498 (GRCm39) Y299H probably damaging Het
Spaca3 G T 11: 80,754,847 (GRCm39) R96L possibly damaging Het
Stat1 A G 1: 52,188,081 (GRCm39) N495S probably benign Het
Tas2r130 T C 6: 131,607,270 (GRCm39) N175S probably benign Het
Tcaf2 A G 6: 42,606,472 (GRCm39) L494P probably damaging Het
Tdrd12 C A 7: 35,179,561 (GRCm39) probably null Het
Thbs1 A G 2: 117,949,837 (GRCm39) N604S probably damaging Het
Togaram1 T C 12: 65,055,454 (GRCm39) F1482L probably benign Het
Trhr2 A T 8: 123,087,114 (GRCm39) S109T probably damaging Het
Trpc3 A T 3: 36,678,562 (GRCm39) M841K probably damaging Het
Tubgcp5 C T 7: 55,473,315 (GRCm39) R798C probably benign Het
Xirp2 T A 2: 67,347,173 (GRCm39) M3138K probably benign Het
Zdhhc4 G A 5: 143,307,646 (GRCm39) T125I probably benign Het
Zfp239 T A 6: 117,848,716 (GRCm39) C151* probably null Het
Zfp473 C T 7: 44,382,627 (GRCm39) E569K not run Het
Zzef1 T A 11: 72,777,516 (GRCm39) D1782E probably damaging Het
Other mutations in Or52w1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00927:Or52w1 APN 7 105,018,454 (GRCm39) missense probably damaging 1.00
IGL01772:Or52w1 APN 7 105,017,641 (GRCm39) missense probably benign 0.03
IGL02508:Or52w1 APN 7 105,017,743 (GRCm39) missense possibly damaging 0.95
IGL03103:Or52w1 APN 7 105,017,785 (GRCm39) missense probably damaging 1.00
R1147:Or52w1 UTSW 7 105,018,484 (GRCm39) missense probably benign 0.14
R1147:Or52w1 UTSW 7 105,018,484 (GRCm39) missense probably benign 0.14
R5237:Or52w1 UTSW 7 105,018,513 (GRCm39) nonsense probably null
R5294:Or52w1 UTSW 7 105,017,620 (GRCm39) missense probably benign 0.41
R5955:Or52w1 UTSW 7 105,017,776 (GRCm39) missense probably damaging 1.00
R6321:Or52w1 UTSW 7 105,018,109 (GRCm39) missense probably damaging 1.00
R7171:Or52w1 UTSW 7 105,017,968 (GRCm39) missense probably benign 0.02
R8376:Or52w1 UTSW 7 105,017,847 (GRCm39) missense probably benign 0.33
R8516:Or52w1 UTSW 7 105,017,976 (GRCm39) missense probably benign 0.00
R9054:Or52w1 UTSW 7 105,017,680 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATGGCAGAAAGTTCGCAGTC -3'
(R):5'- ATAGGGTAGTGTAGTGGACGCC -3'

Sequencing Primer
(F):5'- GGCAGAAAGTTCGCAGTCCAATTC -3'
(R):5'- AGCCCGATCACAGGCCATG -3'
Posted On 2019-06-26