Incidental Mutation 'R0584:Fam98a'
ID56587
Institutional Source Beutler Lab
Gene Symbol Fam98a
Ensembl Gene ENSMUSG00000002017
Gene Namefamily with sequence similarity 98, member A
Synonyms2810405J04Rik
MMRRC Submission 038774-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.644) question?
Stock #R0584 (G1)
Quality Score163
Status Validated
Chromosome17
Chromosomal Location75537086-75551946 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75544777 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 103 (L103P)
Ref Sequence ENSEMBL: ENSMUSP00000108126 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112507]
Predicted Effect probably damaging
Transcript: ENSMUST00000112507
AA Change: L103P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000108126
Gene: ENSMUSG00000002017
AA Change: L103P

DomainStartEndE-ValueType
Pfam:DUF2465 11 328 1.1e-137 PFAM
low complexity region 334 396 N/A INTRINSIC
low complexity region 401 441 N/A INTRINSIC
low complexity region 448 481 N/A INTRINSIC
low complexity region 485 501 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140729
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141969
Meta Mutation Damage Score 0.1422 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.2%
  • 20x: 93.7%
Validation Efficiency 98% (47/48)
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca7 T C 10: 80,011,730 S1745P probably damaging Het
Agfg2 G A 5: 137,667,730 T89I probably damaging Het
Agtr1a A G 13: 30,381,034 I27M probably damaging Het
Armh1 A T 4: 117,229,850 L206Q probably damaging Het
Asxl2 A T 12: 3,496,632 E472V probably damaging Het
Atp2c2 T A 8: 119,738,418 V313E probably benign Het
Casp12 A G 9: 5,352,268 I87V probably null Het
Ccl25 C T 8: 4,354,085 probably benign Het
Col9a1 T C 1: 24,224,490 probably benign Het
Cyth4 A G 15: 78,609,878 probably null Het
Dnah9 A G 11: 65,990,489 Y2587H probably damaging Het
Dppa3 T C 6: 122,629,992 I147T probably benign Het
Fam120b T C 17: 15,402,122 S121P probably damaging Het
Fam209 C T 2: 172,474,161 T152M probably benign Het
Fcho1 T C 8: 71,715,725 Y218C probably damaging Het
Fitm1 T C 14: 55,576,656 V203A probably benign Het
Gcn1l1 G A 5: 115,595,015 R1037Q probably damaging Het
Gm11563 A G 11: 99,658,625 I101T unknown Het
Gpd1l A G 9: 114,914,344 F163L probably damaging Het
Grp C A 18: 65,873,695 A30E possibly damaging Het
H1fnt C A 15: 98,257,077 E64* probably null Het
Icosl T C 10: 78,071,875 Y90H possibly damaging Het
Itsn2 A G 12: 4,697,180 T1194A probably benign Het
Lrp6 A G 6: 134,456,076 S1431P probably damaging Het
Ltbp1 T C 17: 75,363,472 S1503P probably damaging Het
Mef2a G T 7: 67,235,148 S406* probably null Het
Myh13 G T 11: 67,360,374 E1360* probably null Het
Nop58 A G 1: 59,706,760 D400G probably benign Het
Olfr507 T C 7: 108,622,415 L201P probably benign Het
Olfr775 T C 10: 129,250,948 V138A probably benign Het
Oscp1 A G 4: 126,083,594 probably null Het
Pde9a A T 17: 31,459,977 Y264F probably damaging Het
Pkhd1 T A 1: 20,239,436 K2763* probably null Het
Prkci T A 3: 31,025,140 C42* probably null Het
Ptprr T C 10: 116,251,158 V270A probably damaging Het
Rsf1 T A 7: 97,662,128 N688K possibly damaging Het
S1pr3 A T 13: 51,419,661 M293L probably benign Het
Scn10a A C 9: 119,670,531 L232R probably damaging Het
Sirt5 T A 13: 43,394,728 probably null Het
Sp6 C T 11: 97,022,265 T268M probably damaging Het
Spag5 A G 11: 78,304,095 N76S possibly damaging Het
Tecta T C 9: 42,347,908 N1560D possibly damaging Het
Togaram1 T C 12: 64,967,505 L510P probably damaging Het
Umps A G 16: 33,959,124 I401T probably damaging Het
Vars2 A G 17: 35,666,686 V118A possibly damaging Het
Other mutations in Fam98a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00337:Fam98a APN 17 75551747 missense probably damaging 1.00
IGL00548:Fam98a APN 17 75538818 missense probably damaging 1.00
IGL02170:Fam98a APN 17 75540192 critical splice acceptor site probably null
IGL02399:Fam98a APN 17 75538941 splice site probably benign
IGL03062:Fam98a APN 17 75540105 splice site probably benign
IGL03246:Fam98a APN 17 75538853 missense probably damaging 0.99
R0594:Fam98a UTSW 17 75538487 nonsense probably null
R1121:Fam98a UTSW 17 75538534 missense unknown
R1366:Fam98a UTSW 17 75539386 splice site probably benign
R1387:Fam98a UTSW 17 75538269 missense unknown
R1424:Fam98a UTSW 17 75540178 missense probably damaging 1.00
R1533:Fam98a UTSW 17 75541281 missense probably damaging 1.00
R1651:Fam98a UTSW 17 75547715 missense probably benign 0.16
R2211:Fam98a UTSW 17 75538945 critical splice donor site probably null
R4295:Fam98a UTSW 17 75541347 missense probably damaging 1.00
R4350:Fam98a UTSW 17 75541225 missense probably damaging 1.00
R4963:Fam98a UTSW 17 75538982 missense probably damaging 0.99
R5320:Fam98a UTSW 17 75538815 missense probably damaging 1.00
R5383:Fam98a UTSW 17 75538581 missense unknown
R6031:Fam98a UTSW 17 75539432 missense probably damaging 0.98
R6031:Fam98a UTSW 17 75539432 missense probably damaging 0.98
R7058:Fam98a UTSW 17 75538389 missense unknown
R7182:Fam98a UTSW 17 75539018 nonsense probably null
R7505:Fam98a UTSW 17 75538238 missense unknown
R7554:Fam98a UTSW 17 75547675 nonsense probably null
R7566:Fam98a UTSW 17 75547662 missense probably damaging 1.00
R8095:Fam98a UTSW 17 75538771 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGATCAAAGCACCACTGGCGTG -3'
(R):5'- ACAGTTGGGAGGAGTCTTTGAAAGC -3'

Sequencing Primer
(F):5'- ACTGGCGTGCATCCCTC -3'
(R):5'- agtggaaggaggagggatg -3'
Posted On2013-07-11