Incidental Mutation 'R7284:Pfkfb4'
ID 565877
Institutional Source Beutler Lab
Gene Symbol Pfkfb4
Ensembl Gene ENSMUSG00000025648
Gene Name 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase 4
Synonyms
MMRRC Submission 045392-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7284 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 108820846-108861296 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 108840308 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 308 (I308T)
Ref Sequence ENSEMBL: ENSMUSP00000142378 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051873] [ENSMUST00000196249] [ENSMUST00000198140] [ENSMUST00000199591]
AlphaFold Q6DTY7
Predicted Effect possibly damaging
Transcript: ENSMUST00000051873
AA Change: I292T

PolyPhen 2 Score 0.933 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000057197
Gene: ENSMUSG00000025648
AA Change: I292T

DomainStartEndE-ValueType
Pfam:6PF2K 28 249 3.2e-105 PFAM
Pfam:AAA_33 41 199 2.3e-8 PFAM
PGAM 251 398 4.39e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196249
Predicted Effect possibly damaging
Transcript: ENSMUST00000198140
AA Change: I308T

PolyPhen 2 Score 0.878 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142378
Gene: ENSMUSG00000025648
AA Change: I308T

DomainStartEndE-ValueType
Pfam:6PF2K 28 249 1.9e-105 PFAM
Pfam:AAA_33 41 198 8.5e-10 PFAM
PGAM 251 398 4.39e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000199591
AA Change: I308T

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000142992
Gene: ENSMUSG00000025648
AA Change: I308T

DomainStartEndE-ValueType
Pfam:6PF2K 28 249 1.4e-105 PFAM
Pfam:AAA_33 41 198 6.6e-10 PFAM
PGAM 251 396 4.98e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000200015
AA Change: I18T

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.7959 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of four bifunctional kinase/phosphatases that regulate the concentration of the glycolytic byproduct fructose-2,6-bisphosphate (F2,6BP). The encoded protein is highly expressed in cancer cells and is induced by hypoxia. This protein is essential to the survival of cancer cells under conditions of hypoxia, because it increases the amount of F2,6BP and ATP at a time when the cell cannot produce much of them. This finding suggests that this protein may be a good target for disruption in cancer cells, hopefully imperiling their survival. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2015]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2900092C05Rik G T 7: 12,246,605 (GRCm39) E34* probably null Het
4933421I07Rik C T 7: 42,097,404 (GRCm39) R30H probably damaging Het
AB124611 C A 9: 21,450,400 (GRCm39) Q158K probably benign Het
Abcc3 C T 11: 94,247,873 (GRCm39) A1207T probably benign Het
Abcc9 A T 6: 142,628,643 (GRCm39) L367Q probably damaging Het
Aftph T C 11: 20,676,812 (GRCm39) K266E probably benign Het
Akap9 T A 5: 4,006,246 (GRCm39) D190E probably damaging Het
Angel1 G T 12: 86,767,298 (GRCm39) D359E probably damaging Het
Ano6 T C 15: 95,846,184 (GRCm39) I474T probably damaging Het
Atp2c1 A T 9: 105,398,008 (GRCm39) probably null Het
Best1 T C 19: 9,963,737 (GRCm39) probably null Het
Bhlha9 A G 11: 76,563,492 (GRCm39) S40G probably benign Het
Cabin1 G A 10: 75,530,668 (GRCm39) R178C Het
Ccnb1ip1 A G 14: 51,029,736 (GRCm39) Y109H probably damaging Het
Col14a1 T C 15: 55,381,715 (GRCm39) S1763P probably damaging Het
Dars1 T C 1: 128,300,004 (GRCm39) T327A probably benign Het
Dhx8 T C 11: 101,645,648 (GRCm39) Y889H probably damaging Het
Dlg4 T A 11: 69,932,908 (GRCm39) Y523* probably null Het
Dnah10 A T 5: 124,909,662 (GRCm39) D4484V probably benign Het
Dnah9 A T 11: 65,881,302 (GRCm39) M2591K probably damaging Het
Dock2 T C 11: 34,180,672 (GRCm39) E1715G probably benign Het
Dym A G 18: 75,252,242 (GRCm39) Y336C possibly damaging Het
Ezh2 A G 6: 47,521,453 (GRCm39) M439T probably benign Het
Folr1 T G 7: 101,508,677 (GRCm39) N83H possibly damaging Het
Ganab T C 19: 8,889,904 (GRCm39) L656P probably damaging Het
Gmnc T C 16: 26,779,542 (GRCm39) H161R probably benign Het
Gria4 A G 9: 4,472,017 (GRCm39) Y491H probably damaging Het
Heatr3 T A 8: 88,883,402 (GRCm39) C412S possibly damaging Het
Hmgcr A C 13: 96,789,173 (GRCm39) V716G probably damaging Het
Igsf9 A G 1: 172,324,479 (GRCm39) D799G probably damaging Het
Ikbkb T C 8: 23,158,976 (GRCm39) T501A probably benign Het
Kbtbd3 C T 9: 4,330,690 (GRCm39) R355* probably null Het
Kcna7 T A 7: 45,058,652 (GRCm39) I313N probably damaging Het
Kirrel1 A C 3: 86,990,694 (GRCm39) D709E probably benign Het
Klb T A 5: 65,540,821 (GRCm39) S971R probably benign Het
Krtap4-13 A T 11: 99,700,238 (GRCm39) C140* probably null Het
Lacc1 A T 14: 77,268,309 (GRCm39) L334Q probably damaging Het
Map6d1 T A 16: 20,059,775 (GRCm39) R97* probably null Het
Mgat5b T C 11: 116,835,746 (GRCm39) S129P probably damaging Het
Mmp1a TG TGG 9: 7,465,083 (GRCm38) probably null Het
Myh9 G A 15: 77,671,796 (GRCm39) R432C probably damaging Het
Ncf4 A G 15: 78,144,902 (GRCm39) T236A probably benign Het
Neb T C 2: 52,148,804 (GRCm39) D2581G probably damaging Het
Nid1 T A 13: 13,663,675 (GRCm39) M778K probably benign Het
Npas2 A G 1: 39,363,548 (GRCm39) D209G probably benign Het
Nploc4 C T 11: 120,307,196 (GRCm39) V181I possibly damaging Het
Nrcam A T 12: 44,610,817 (GRCm39) I506F probably damaging Het
Or52w1 T A 7: 105,017,752 (GRCm39) M73K probably damaging Het
Or5h27 A G 16: 59,006,331 (GRCm39) *172Q probably null Het
Or6c3b T C 10: 129,527,220 (GRCm39) N230S probably benign Het
Pask T A 1: 93,248,391 (GRCm39) Q970L probably benign Het
Pla2g4d A T 2: 120,114,617 (GRCm39) L38Q probably damaging Het
Pld1 A G 3: 28,185,882 (GRCm39) T1036A possibly damaging Het
Pom121l2 A G 13: 22,166,775 (GRCm39) T349A probably damaging Het
Ppp1r13b A G 12: 111,801,400 (GRCm39) I551T possibly damaging Het
Prps1l1 A G 12: 35,035,317 (GRCm39) N144S possibly damaging Het
Prss56 A G 1: 87,113,123 (GRCm39) N179S probably null Het
Prune2 T C 19: 17,097,250 (GRCm39) L918P probably damaging Het
Ptprz1 C T 6: 23,000,097 (GRCm39) T729I probably damaging Het
Relch T A 1: 105,662,308 (GRCm39) H942Q probably benign Het
Rrp7a T C 15: 83,006,071 (GRCm39) T60A probably damaging Het
Snx27 A G 3: 94,431,498 (GRCm39) Y299H probably damaging Het
Spaca3 G T 11: 80,754,847 (GRCm39) R96L possibly damaging Het
Stat1 A G 1: 52,188,081 (GRCm39) N495S probably benign Het
Tas2r130 T C 6: 131,607,270 (GRCm39) N175S probably benign Het
Tcaf2 A G 6: 42,606,472 (GRCm39) L494P probably damaging Het
Tdrd12 C A 7: 35,179,561 (GRCm39) probably null Het
Thbs1 A G 2: 117,949,837 (GRCm39) N604S probably damaging Het
Togaram1 T C 12: 65,055,454 (GRCm39) F1482L probably benign Het
Trhr2 A T 8: 123,087,114 (GRCm39) S109T probably damaging Het
Trpc3 A T 3: 36,678,562 (GRCm39) M841K probably damaging Het
Tubgcp5 C T 7: 55,473,315 (GRCm39) R798C probably benign Het
Xirp2 T A 2: 67,347,173 (GRCm39) M3138K probably benign Het
Zdhhc4 G A 5: 143,307,646 (GRCm39) T125I probably benign Het
Zfp239 T A 6: 117,848,716 (GRCm39) C151* probably null Het
Zfp473 C T 7: 44,382,627 (GRCm39) E569K not run Het
Zzef1 T A 11: 72,777,516 (GRCm39) D1782E probably damaging Het
Other mutations in Pfkfb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01653:Pfkfb4 APN 9 108,828,202 (GRCm39) missense probably damaging 1.00
IGL01978:Pfkfb4 APN 9 108,858,010 (GRCm39) missense probably damaging 1.00
IGL02119:Pfkfb4 APN 9 108,854,178 (GRCm39) missense probably damaging 1.00
IGL02121:Pfkfb4 APN 9 108,854,178 (GRCm39) missense probably damaging 1.00
IGL02122:Pfkfb4 APN 9 108,854,178 (GRCm39) missense probably damaging 1.00
IGL02123:Pfkfb4 APN 9 108,854,178 (GRCm39) missense probably damaging 1.00
IGL02125:Pfkfb4 APN 9 108,854,178 (GRCm39) missense probably damaging 1.00
IGL02126:Pfkfb4 APN 9 108,854,178 (GRCm39) missense probably damaging 1.00
IGL02506:Pfkfb4 APN 9 108,859,404 (GRCm39) missense probably benign 0.00
IGL02881:Pfkfb4 APN 9 108,836,364 (GRCm39) missense probably null 1.00
PIT4466001:Pfkfb4 UTSW 9 108,828,222 (GRCm39) missense probably benign 0.12
PIT4472001:Pfkfb4 UTSW 9 108,828,222 (GRCm39) missense probably benign 0.12
R0087:Pfkfb4 UTSW 9 108,836,769 (GRCm39) missense probably damaging 1.00
R0101:Pfkfb4 UTSW 9 108,839,711 (GRCm39) missense probably benign 0.03
R0109:Pfkfb4 UTSW 9 108,827,957 (GRCm39) missense probably benign 0.27
R0109:Pfkfb4 UTSW 9 108,827,957 (GRCm39) missense probably benign 0.27
R0379:Pfkfb4 UTSW 9 108,856,810 (GRCm39) splice site probably benign
R0511:Pfkfb4 UTSW 9 108,856,825 (GRCm39) missense probably damaging 1.00
R1146:Pfkfb4 UTSW 9 108,836,794 (GRCm39) missense probably benign 0.00
R1146:Pfkfb4 UTSW 9 108,836,794 (GRCm39) missense probably benign 0.00
R1490:Pfkfb4 UTSW 9 108,856,688 (GRCm39) missense probably damaging 1.00
R1521:Pfkfb4 UTSW 9 108,836,373 (GRCm39) missense probably damaging 1.00
R1932:Pfkfb4 UTSW 9 108,828,237 (GRCm39) missense probably damaging 1.00
R2214:Pfkfb4 UTSW 9 108,834,677 (GRCm39) missense probably benign 0.17
R3112:Pfkfb4 UTSW 9 108,854,110 (GRCm39) splice site probably benign
R5470:Pfkfb4 UTSW 9 108,856,661 (GRCm39) missense probably damaging 1.00
R5646:Pfkfb4 UTSW 9 108,837,489 (GRCm39) missense probably damaging 1.00
R5930:Pfkfb4 UTSW 9 108,859,462 (GRCm39) unclassified probably benign
R6139:Pfkfb4 UTSW 9 108,856,825 (GRCm39) missense probably damaging 1.00
R6632:Pfkfb4 UTSW 9 108,838,630 (GRCm39) splice site probably null
R6873:Pfkfb4 UTSW 9 108,839,403 (GRCm39) splice site probably null
R6958:Pfkfb4 UTSW 9 108,839,615 (GRCm39) missense probably damaging 1.00
R7098:Pfkfb4 UTSW 9 108,828,222 (GRCm39) missense probably benign 0.05
R7131:Pfkfb4 UTSW 9 108,836,370 (GRCm39) missense probably benign 0.21
R7148:Pfkfb4 UTSW 9 108,856,676 (GRCm39) missense probably damaging 0.99
R7903:Pfkfb4 UTSW 9 108,828,019 (GRCm39) missense probably damaging 1.00
R7973:Pfkfb4 UTSW 9 108,854,179 (GRCm39) missense probably damaging 1.00
R8506:Pfkfb4 UTSW 9 108,834,667 (GRCm39) missense possibly damaging 0.80
Predicted Primers PCR Primer
(F):5'- GGATGTGTACACCATTGGGAAG -3'
(R):5'- ATGACTACCCTACATTATTCTCCAG -3'

Sequencing Primer
(F):5'- TACACCATTGGGAAGTTAGTGTGAC -3'
(R):5'- ATTATTCTCCAGACCATACTGAGC -3'
Posted On 2019-06-26