Incidental Mutation 'R7284:Olfr803'
ID565879
Institutional Source Beutler Lab
Gene Symbol Olfr803
Ensembl Gene ENSMUSG00000046041
Gene Nameolfactory receptor 803
SynonymsGA_x6K02T2PULF-11370664-11369738, MOR111-3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.060) question?
Stock #R7284 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location129690621-129694286 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 129691351 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 230 (N230S)
Ref Sequence ENSEMBL: ENSMUSP00000145400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056736] [ENSMUST00000203785] [ENSMUST00000204641] [ENSMUST00000217576]
Predicted Effect probably benign
Transcript: ENSMUST00000056736
AA Change: N230S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000055860
Gene: ENSMUSG00000046041
AA Change: N230S

DomainStartEndE-ValueType
Pfam:7tm_4 28 306 6.2e-51 PFAM
Pfam:7TM_GPCR_Srsx 33 303 3.8e-6 PFAM
Pfam:7tm_1 39 288 3.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203785
SMART Domains Protein: ENSMUSP00000144741
Gene: ENSMUSG00000093866

DomainStartEndE-ValueType
Pfam:7tm_4 28 305 6.8e-56 PFAM
Pfam:7tm_1 39 288 2.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204641
AA Change: N230S

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000145400
Gene: ENSMUSG00000046041
AA Change: N230S

DomainStartEndE-ValueType
Pfam:7tm_4 29 307 2.9e-49 PFAM
Pfam:7tm_1 39 288 8.3e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217576
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,734,583 H942Q probably benign Het
2900092C05Rik G T 7: 12,512,678 E34* probably null Het
4933421I07Rik C T 7: 42,447,980 R30H probably damaging Het
AB124611 C A 9: 21,539,104 Q158K probably benign Het
Abcc3 C T 11: 94,357,047 A1207T probably benign Het
Abcc9 A T 6: 142,682,917 L367Q probably damaging Het
Aftph T C 11: 20,726,812 K266E probably benign Het
Akap9 T A 5: 3,956,246 D190E probably damaging Het
Angel1 G T 12: 86,720,524 D359E probably damaging Het
Ano6 T C 15: 95,948,303 I474T probably damaging Het
Atp2c1 A T 9: 105,520,809 probably null Het
Best1 T C 19: 9,986,373 probably null Het
Bhlha9 A G 11: 76,672,666 S40G probably benign Het
Cabin1 G A 10: 75,694,834 R178C Het
Ccnb1ip1 A G 14: 50,792,279 Y109H probably damaging Het
Col14a1 T C 15: 55,518,319 S1763P probably damaging Het
Dars T C 1: 128,372,267 T327A probably benign Het
Dhx8 T C 11: 101,754,822 Y889H probably damaging Het
Dlg4 T A 11: 70,042,082 Y523* probably null Het
Dnah10 A T 5: 124,832,598 D4484V probably benign Het
Dnah9 A T 11: 65,990,476 M2591K probably damaging Het
Dock2 T C 11: 34,230,672 E1715G probably benign Het
Dym A G 18: 75,119,171 Y336C possibly damaging Het
Ezh2 A G 6: 47,544,519 M439T probably benign Het
Folr1 T G 7: 101,859,470 N83H possibly damaging Het
Ganab T C 19: 8,912,540 L656P probably damaging Het
Gmnc T C 16: 26,960,792 H161R probably benign Het
Gria4 A G 9: 4,472,017 Y491H probably damaging Het
Heatr3 T A 8: 88,156,774 C412S possibly damaging Het
Hmgcr A C 13: 96,652,665 V716G probably damaging Het
Igsf9 A G 1: 172,496,912 D799G probably damaging Het
Ikbkb T C 8: 22,668,960 T501A probably benign Het
Kbtbd3 C T 9: 4,330,690 R355* probably null Het
Kcna7 T A 7: 45,409,228 I313N probably damaging Het
Kirrel A C 3: 87,083,387 D709E probably benign Het
Klb T A 5: 65,383,478 S971R probably benign Het
Krtap4-13 A T 11: 99,809,412 C140* probably null Het
Lacc1 A T 14: 77,030,869 L334Q probably damaging Het
Map6d1 T A 16: 20,241,025 R97* probably null Het
Mgat5b T C 11: 116,944,920 S129P probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Myh9 G A 15: 77,787,596 R432C probably damaging Het
Ncf4 A G 15: 78,260,702 T236A probably benign Het
Neb T C 2: 52,258,792 D2581G probably damaging Het
Nid1 T A 13: 13,489,090 M778K probably benign Het
Npas2 A G 1: 39,324,467 D209G probably benign Het
Nploc4 C T 11: 120,416,370 V181I possibly damaging Het
Nrcam A T 12: 44,564,034 I506F probably damaging Het
Olfr197 A G 16: 59,185,968 *172Q probably null Het
Olfr692 T A 7: 105,368,545 M73K probably damaging Het
Pask T A 1: 93,320,669 Q970L probably benign Het
Pfkfb4 T C 9: 109,011,240 I308T possibly damaging Het
Pla2g4d A T 2: 120,284,136 L38Q probably damaging Het
Pld1 A G 3: 28,131,733 T1036A possibly damaging Het
Pom121l2 A G 13: 21,982,605 T349A probably damaging Het
Ppp1r13b A G 12: 111,834,966 I551T possibly damaging Het
Prps1l1 A G 12: 34,985,318 N144S possibly damaging Het
Prss56 A G 1: 87,185,401 N179S probably null Het
Prune2 T C 19: 17,119,886 L918P probably damaging Het
Ptprz1 C T 6: 23,000,098 T729I probably damaging Het
Rrp7a T C 15: 83,121,870 T60A probably damaging Het
Snx27 A G 3: 94,524,191 Y299H probably damaging Het
Spaca3 G T 11: 80,864,021 R96L possibly damaging Het
Stat1 A G 1: 52,148,922 N495S probably benign Het
Tas2r130 T C 6: 131,630,307 N175S probably benign Het
Tcaf2 A G 6: 42,629,538 L494P probably damaging Het
Tdrd12 C A 7: 35,480,136 probably null Het
Thbs1 A G 2: 118,119,356 N604S probably damaging Het
Togaram1 T C 12: 65,008,680 F1482L probably benign Het
Trhr2 A T 8: 122,360,375 S109T probably damaging Het
Trpc3 A T 3: 36,624,413 M841K probably damaging Het
Tubgcp5 C T 7: 55,823,567 R798C probably benign Het
Xirp2 T A 2: 67,516,829 M3138K probably benign Het
Zdhhc4 G A 5: 143,321,891 T125I probably benign Het
Zfp239 T A 6: 117,871,755 C151* probably null Het
Zfp473 C T 7: 44,733,203 E569K not run Het
Zzef1 T A 11: 72,886,690 D1782E probably damaging Het
Other mutations in Olfr803
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00922:Olfr803 APN 10 129691454 missense probably benign 0.00
IGL01298:Olfr803 APN 10 129692029 missense probably damaging 0.98
IGL02008:Olfr803 APN 10 129692018 missense probably benign 0.02
IGL02166:Olfr803 APN 10 129691913 missense probably benign 0.12
IGL02598:Olfr803 APN 10 129691273 missense possibly damaging 0.89
IGL03158:Olfr803 APN 10 129691718 missense probably benign 0.01
IGL03393:Olfr803 APN 10 129691278 missense probably damaging 0.99
R2246:Olfr803 UTSW 10 129691943 missense probably damaging 1.00
R3749:Olfr803 UTSW 10 129691961 missense probably benign
R5060:Olfr803 UTSW 10 129691830 missense probably benign
R5116:Olfr803 UTSW 10 129691397 missense probably damaging 1.00
R5253:Olfr803 UTSW 10 129691732 missense probably damaging 0.99
R6166:Olfr803 UTSW 10 129691279 missense probably damaging 1.00
R6543:Olfr803 UTSW 10 129691990 missense probably benign 0.09
R6787:Olfr803 UTSW 10 129691522 missense possibly damaging 0.88
R6828:Olfr803 UTSW 10 129691994 missense probably damaging 1.00
R7510:Olfr803 UTSW 10 129691920 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTTTACTTGCTGGTTCCTCAAAG -3'
(R):5'- ACCACTTATGCTGGTCCTAAAG -3'

Sequencing Primer
(F):5'- GCAACTGAAGTGCTGAGA -3'
(R):5'- AATGTCATTGATCACTTCTGCTGTG -3'
Posted On2019-06-26