Mutagenetix > Incidental Mutation

Incidental Mutation 'R7284:Zzef1'

565884

Institutional Source

Beutler Lab

Gene Symbol

Zzef1

Ensembl Gene

ENSMUSG00000055670

Gene Name

zinc finger, ZZ-type with EF hand domain 1

Synonyms

C130099L13Rik, 8430405D05Rik

MMRRC Submission

045392-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7284 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

72796226-72927120 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 72886690 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glutamic Acid at position 1782 (D1782E)

Ref Sequence

ENSEMBL: ENSMUSP00000147028 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000069395] [ENSMUST00000172220] [ENSMUST00000207107]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000069395
AA Change: D1782E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000068790
Gene: ENSMUSG00000055670
AA Change: D1782E

Domain	Start	End	E-Value	Type
low complexity region	4	20	N/A	INTRINSIC
low complexity region	28	68	N/A	INTRINSIC
low complexity region	78	93	N/A	INTRINSIC
APC10	246	397	2.65e-48	SMART
internal_repeat_1	1122	1192	1.25e-7	PROSPERO
low complexity region	1472	1485	N/A	INTRINSIC
low complexity region	1512	1525	N/A	INTRINSIC
ZnF_ZZ	1775	1823	2.54e-7	SMART
ZnF_ZZ	1824	1868	1.2e-8	SMART
low complexity region	1947	1963	N/A	INTRINSIC
low complexity region	2127	2140	N/A	INTRINSIC
low complexity region	2249	2263	N/A	INTRINSIC
internal_repeat_1	2657	2726	1.25e-7	PROSPERO
low complexity region	2840	2853	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000172220
AA Change: D1782E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000130515
Gene: ENSMUSG00000055670
AA Change: D1782E

Domain	Start	End	E-Value	Type
low complexity region	4	20	N/A	INTRINSIC
low complexity region	28	68	N/A	INTRINSIC
low complexity region	78	93	N/A	INTRINSIC
APC10	246	397	2.65e-48	SMART
internal_repeat_1	1006	1192	1.57e-16	PROSPERO
low complexity region	1472	1485	N/A	INTRINSIC
low complexity region	1512	1525	N/A	INTRINSIC
ZnF_ZZ	1775	1823	2.54e-7	SMART
ZnF_ZZ	1824	1868	1.2e-8	SMART
low complexity region	1947	1963	N/A	INTRINSIC
low complexity region	2127	2140	N/A	INTRINSIC
low complexity region	2249	2263	N/A	INTRINSIC
internal_repeat_1	2583	2759	1.57e-16	PROSPERO
low complexity region	2873	2886	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000207107
AA Change: D1782E

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.3%

Validation Efficiency

99% (77/78)

Allele List at MGI

Other mutations in this stock

Total: 77 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2310035C23Rik	T	A	1: 105,734,583	H942Q	probably benign	Het
2900092C05Rik	G	T	7: 12,512,678	E34*	probably null	Het
4933421I07Rik	C	T	7: 42,447,980	R30H	probably damaging	Het
AB124611	C	A	9: 21,539,104	Q158K	probably benign	Het
Abcc3	C	T	11: 94,357,047	A1207T	probably benign	Het
Abcc9	A	T	6: 142,682,917	L367Q	probably damaging	Het
Aftph	T	C	11: 20,726,812	K266E	probably benign	Het
Akap9	T	A	5: 3,956,246	D190E	probably damaging	Het
Angel1	G	T	12: 86,720,524	D359E	probably damaging	Het
Ano6	T	C	15: 95,948,303	I474T	probably damaging	Het
Atp2c1	A	T	9: 105,520,809		probably null	Het
Best1	T	C	19: 9,986,373		probably null	Het
Bhlha9	A	G	11: 76,672,666	S40G	probably benign	Het
Cabin1	G	A	10: 75,694,834	R178C		Het
Ccnb1ip1	A	G	14: 50,792,279	Y109H	probably damaging	Het
Col14a1	T	C	15: 55,518,319	S1763P	probably damaging	Het
Dars	T	C	1: 128,372,267	T327A	probably benign	Het
Dhx8	T	C	11: 101,754,822	Y889H	probably damaging	Het
Dlg4	T	A	11: 70,042,082	Y523*	probably null	Het
Dnah10	A	T	5: 124,832,598	D4484V	probably benign	Het
Dnah9	A	T	11: 65,990,476	M2591K	probably damaging	Het
Dock2	T	C	11: 34,230,672	E1715G	probably benign	Het
Dym	A	G	18: 75,119,171	Y336C	possibly damaging	Het
Ezh2	A	G	6: 47,544,519	M439T	probably benign	Het
Folr1	T	G	7: 101,859,470	N83H	possibly damaging	Het
Ganab	T	C	19: 8,912,540	L656P	probably damaging	Het
Gmnc	T	C	16: 26,960,792	H161R	probably benign	Het
Gria4	A	G	9: 4,472,017	Y491H	probably damaging	Het
Heatr3	T	A	8: 88,156,774	C412S	possibly damaging	Het
Hmgcr	A	C	13: 96,652,665	V716G	probably damaging	Het
Igsf9	A	G	1: 172,496,912	D799G	probably damaging	Het
Ikbkb	T	C	8: 22,668,960	T501A	probably benign	Het
Kbtbd3	C	T	9: 4,330,690	R355*	probably null	Het
Kcna7	T	A	7: 45,409,228	I313N	probably damaging	Het
Kirrel	A	C	3: 87,083,387	D709E	probably benign	Het
Klb	T	A	5: 65,383,478	S971R	probably benign	Het
Krtap4-13	A	T	11: 99,809,412	C140*	probably null	Het
Lacc1	A	T	14: 77,030,869	L334Q	probably damaging	Het
Map6d1	T	A	16: 20,241,025	R97*	probably null	Het
Mgat5b	T	C	11: 116,944,920	S129P	probably damaging	Het
Mmp1a	TG	TGG	9: 7,465,083		probably null	Het
Myh9	G	A	15: 77,787,596	R432C	probably damaging	Het
Ncf4	A	G	15: 78,260,702	T236A	probably benign	Het
Neb	T	C	2: 52,258,792	D2581G	probably damaging	Het
Nid1	T	A	13: 13,489,090	M778K	probably benign	Het
Npas2	A	G	1: 39,324,467	D209G	probably benign	Het
Nploc4	C	T	11: 120,416,370	V181I	possibly damaging	Het
Nrcam	A	T	12: 44,564,034	I506F	probably damaging	Het
Olfr197	A	G	16: 59,185,968	*172Q	probably null	Het
Olfr692	T	A	7: 105,368,545	M73K	probably damaging	Het
Olfr803	T	C	10: 129,691,351	N230S	probably benign	Het
Pask	T	A	1: 93,320,669	Q970L	probably benign	Het
Pfkfb4	T	C	9: 109,011,240	I308T	possibly damaging	Het
Pla2g4d	A	T	2: 120,284,136	L38Q	probably damaging	Het
Pld1	A	G	3: 28,131,733	T1036A	possibly damaging	Het
Pom121l2	A	G	13: 21,982,605	T349A	probably damaging	Het
Ppp1r13b	A	G	12: 111,834,966	I551T	possibly damaging	Het
Prps1l1	A	G	12: 34,985,318	N144S	possibly damaging	Het
Prss56	A	G	1: 87,185,401	N179S	probably null	Het
Prune2	T	C	19: 17,119,886	L918P	probably damaging	Het
Ptprz1	C	T	6: 23,000,098	T729I	probably damaging	Het
Rrp7a	T	C	15: 83,121,870	T60A	probably damaging	Het
Snx27	A	G	3: 94,524,191	Y299H	probably damaging	Het
Spaca3	G	T	11: 80,864,021	R96L	possibly damaging	Het
Stat1	A	G	1: 52,148,922	N495S	probably benign	Het
Tas2r130	T	C	6: 131,630,307	N175S	probably benign	Het
Tcaf2	A	G	6: 42,629,538	L494P	probably damaging	Het
Tdrd12	C	A	7: 35,480,136		probably null	Het
Thbs1	A	G	2: 118,119,356	N604S	probably damaging	Het
Togaram1	T	C	12: 65,008,680	F1482L	probably benign	Het
Trhr2	A	T	8: 122,360,375	S109T	probably damaging	Het
Trpc3	A	T	3: 36,624,413	M841K	probably damaging	Het
Tubgcp5	C	T	7: 55,823,567	R798C	probably benign	Het
Xirp2	T	A	2: 67,516,829	M3138K	probably benign	Het
Zdhhc4	G	A	5: 143,321,891	T125I	probably benign	Het
Zfp239	T	A	6: 117,871,755	C151*	probably null	Het
Zfp473	C	T	7: 44,733,203	E569K	not run	Het

Other mutations in Zzef1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00092:Zzef1	APN	11	72875126	missense	probably benign	0.02
IGL00898:Zzef1	APN	11	72875173	missense	probably benign	0.00
IGL00970:Zzef1	APN	11	72915245	missense	probably benign	0.06
IGL01062:Zzef1	APN	11	72874969	missense	probably benign
IGL01832:Zzef1	APN	11	72875066	missense	probably damaging	0.99
IGL02005:Zzef1	APN	11	72888299	missense	probably benign	0.00
IGL02026:Zzef1	APN	11	72881338	missense	probably benign	0.39
IGL02110:Zzef1	APN	11	72913112	missense	probably damaging	1.00
IGL02305:Zzef1	APN	11	72866597	splice site	probably benign
IGL02308:Zzef1	APN	11	72886747	missense	probably benign	0.04
IGL02315:Zzef1	APN	11	72875257	nonsense	probably null
IGL02332:Zzef1	APN	11	72916509	missense	probably benign	0.01
IGL02389:Zzef1	APN	11	72891217	missense	probably benign
IGL02389:Zzef1	APN	11	72899538	missense	possibly damaging	0.89
IGL02451:Zzef1	APN	11	72901388	missense	probably damaging	0.99
IGL02541:Zzef1	APN	11	72872649	missense	probably damaging	1.00
IGL02950:Zzef1	APN	11	72917699	splice site	probably benign
IGL02953:Zzef1	APN	11	72855398	missense	probably benign
IGL03053:Zzef1	APN	11	72831539	splice site	probably benign
IGL03085:Zzef1	APN	11	72855524	splice site	probably benign
IGL03152:Zzef1	APN	11	72923182	critical splice donor site	probably null
IGL03329:Zzef1	APN	11	72917273	splice site	probably benign
IGL03376:Zzef1	APN	11	72876551	splice site	probably benign
IGL03394:Zzef1	APN	11	72886775	splice site	probably null
Dreidel	UTSW	11	72908469	nonsense	probably null
Hanukkah	UTSW	11	72893332	missense	probably benign	0.00
Mezuzah	UTSW	11	72848733	nonsense	probably null
BB005:Zzef1	UTSW	11	72821896	missense	probably damaging	0.99
BB015:Zzef1	UTSW	11	72821896	missense	probably damaging	0.99
PIT4508001:Zzef1	UTSW	11	72895176	missense	probably benign
PIT4581001:Zzef1	UTSW	11	72899672	missense	probably benign	0.00
PIT4810001:Zzef1	UTSW	11	72850745	missense	probably damaging	1.00
R0094:Zzef1	UTSW	11	72817965	missense	probably benign	0.01
R0119:Zzef1	UTSW	11	72821851	missense	probably benign
R0136:Zzef1	UTSW	11	72821851	missense	probably benign
R0140:Zzef1	UTSW	11	72899551	missense	possibly damaging	0.70
R0212:Zzef1	UTSW	11	72873910	missense	possibly damaging	0.66
R0217:Zzef1	UTSW	11	72889068	missense	probably damaging	1.00
R0220:Zzef1	UTSW	11	72865966	missense	probably damaging	1.00
R0304:Zzef1	UTSW	11	72880624	missense	probably benign	0.10
R0400:Zzef1	UTSW	11	72895242	missense	probably damaging	1.00
R0422:Zzef1	UTSW	11	72866091	missense	possibly damaging	0.93
R0471:Zzef1	UTSW	11	72923111	missense	probably damaging	1.00
R0557:Zzef1	UTSW	11	72917730	missense	probably damaging	1.00
R0581:Zzef1	UTSW	11	72851900	missense	probably benign	0.00
R0599:Zzef1	UTSW	11	72913178	missense	probably damaging	1.00
R0603:Zzef1	UTSW	11	72818069	missense	probably benign	0.00
R0657:Zzef1	UTSW	11	72821851	missense	probably benign
R0987:Zzef1	UTSW	11	72901333	small deletion	probably benign
R1246:Zzef1	UTSW	11	72874909	missense	probably benign	0.00
R1327:Zzef1	UTSW	11	72893414	critical splice donor site	probably null
R1438:Zzef1	UTSW	11	72912945	missense	probably damaging	0.96
R1466:Zzef1	UTSW	11	72924679	missense	probably damaging	1.00
R1466:Zzef1	UTSW	11	72924679	missense	probably damaging	1.00
R1485:Zzef1	UTSW	11	72900809	splice site	probably null
R1556:Zzef1	UTSW	11	72915233	missense	probably damaging	1.00
R1563:Zzef1	UTSW	11	72848733	nonsense	probably null
R1584:Zzef1	UTSW	11	72924679	missense	probably damaging	1.00
R1643:Zzef1	UTSW	11	72826202	missense	probably damaging	1.00
R1646:Zzef1	UTSW	11	72864036	critical splice donor site	probably null
R1764:Zzef1	UTSW	11	72893332	missense	probably benign	0.00
R1777:Zzef1	UTSW	11	72910272	missense	probably damaging	1.00
R1793:Zzef1	UTSW	11	72886709	missense	probably damaging	1.00
R1900:Zzef1	UTSW	11	72848714	missense	probably damaging	0.99
R2096:Zzef1	UTSW	11	72872639	missense	probably benign	0.02
R2134:Zzef1	UTSW	11	72880624	missense	probably benign	0.02
R2157:Zzef1	UTSW	11	72848634	splice site	probably benign
R2183:Zzef1	UTSW	11	72886718	nonsense	probably null
R2192:Zzef1	UTSW	11	72910156	splice site	probably null
R2230:Zzef1	UTSW	11	72884416	missense	probably damaging	0.99
R2259:Zzef1	UTSW	11	72900633	nonsense	probably null
R2384:Zzef1	UTSW	11	72858394	missense	probably damaging	0.99
R2426:Zzef1	UTSW	11	72915265	missense	probably benign	0.01
R2915:Zzef1	UTSW	11	72910326	splice site	probably null
R3700:Zzef1	UTSW	11	72886772	missense	probably null	1.00
R3875:Zzef1	UTSW	11	72889040	missense	probably benign	0.22
R3902:Zzef1	UTSW	11	72908500	missense	probably damaging	1.00
R3927:Zzef1	UTSW	11	72858382	missense	probably damaging	1.00
R4086:Zzef1	UTSW	11	72875053	missense	probably benign	0.02
R4301:Zzef1	UTSW	11	72889035	missense	probably damaging	0.96
R4359:Zzef1	UTSW	11	72823508	missense	probably damaging	0.98
R4382:Zzef1	UTSW	11	72875112	missense	probably benign	0.00
R4453:Zzef1	UTSW	11	72872639	missense	probably benign	0.02
R4466:Zzef1	UTSW	11	72924659	missense	probably damaging	1.00
R4471:Zzef1	UTSW	11	72913331	missense	probably damaging	1.00
R4510:Zzef1	UTSW	11	72888170	missense	probably benign	0.32
R4511:Zzef1	UTSW	11	72888170	missense	probably benign	0.32
R4714:Zzef1	UTSW	11	72837212	missense	probably damaging	1.00
R4799:Zzef1	UTSW	11	72859623	missense	probably benign	0.12
R4906:Zzef1	UTSW	11	72901388	missense	probably damaging	1.00
R5075:Zzef1	UTSW	11	72858344	missense	probably damaging	1.00
R5357:Zzef1	UTSW	11	72843333	nonsense	probably null
R5579:Zzef1	UTSW	11	72900637	missense	probably damaging	0.98
R5598:Zzef1	UTSW	11	72916521	missense	probably damaging	1.00
R5725:Zzef1	UTSW	11	72855482	missense	possibly damaging	0.86
R5765:Zzef1	UTSW	11	72821937	nonsense	probably null
R5928:Zzef1	UTSW	11	72912852	missense	probably damaging	1.00
R6003:Zzef1	UTSW	11	72824065	splice site	probably null
R6047:Zzef1	UTSW	11	72866095	missense	probably damaging	0.99
R6224:Zzef1	UTSW	11	72855383	missense	probably damaging	0.99
R6225:Zzef1	UTSW	11	72869805	missense	possibly damaging	0.62
R6287:Zzef1	UTSW	11	72923112	missense	probably damaging	1.00
R6361:Zzef1	UTSW	11	72884349	missense	possibly damaging	0.93
R6451:Zzef1	UTSW	11	72923156	missense	possibly damaging	0.88
R6467:Zzef1	UTSW	11	72911264	critical splice donor site	probably null
R6484:Zzef1	UTSW	11	72895271	missense	probably damaging	1.00
R6493:Zzef1	UTSW	11	72913303	missense	probably benign	0.06
R6520:Zzef1	UTSW	11	72826065	missense	probably damaging	1.00
R6527:Zzef1	UTSW	11	72874990	missense	probably benign	0.00
R6540:Zzef1	UTSW	11	72913229	missense	probably damaging	1.00
R6608:Zzef1	UTSW	11	72912826	missense	probably damaging	1.00
R6795:Zzef1	UTSW	11	72850659	missense	probably benign	0.00
R6927:Zzef1	UTSW	11	72913157	missense	probably damaging	1.00
R6987:Zzef1	UTSW	11	72855514	missense	possibly damaging	0.89
R7048:Zzef1	UTSW	11	72866699	nonsense	probably null
R7076:Zzef1	UTSW	11	72899559	missense	probably benign	0.00
R7099:Zzef1	UTSW	11	72872649	missense	possibly damaging	0.92
R7132:Zzef1	UTSW	11	72917871	critical splice donor site	probably null
R7175:Zzef1	UTSW	11	72851901	missense	possibly damaging	0.49
R7300:Zzef1	UTSW	11	72875004	missense	probably benign	0.02
R7486:Zzef1	UTSW	11	72864786	missense	possibly damaging	0.85
R7503:Zzef1	UTSW	11	72826067	missense	probably damaging	1.00
R7679:Zzef1	UTSW	11	72893278	missense	probably benign
R7874:Zzef1	UTSW	11	72859653	missense	probably benign	0.01
R7898:Zzef1	UTSW	11	72796547	missense	probably damaging	1.00
R7928:Zzef1	UTSW	11	72821896	missense	probably damaging	0.99
R8021:Zzef1	UTSW	11	72823416	missense	probably damaging	0.99
R8145:Zzef1	UTSW	11	72908469	nonsense	probably null
R8255:Zzef1	UTSW	11	72875129	missense	probably benign	0.00
R8303:Zzef1	UTSW	11	72917189	missense	probably damaging	1.00
R8492:Zzef1	UTSW	11	72872604	missense	probably damaging	1.00
R8492:Zzef1	UTSW	11	72886746	missense	probably damaging	0.97
R8498:Zzef1	UTSW	11	72853322	missense	probably damaging	1.00
R8547:Zzef1	UTSW	11	72844441	missense	probably damaging	1.00
R8874:Zzef1	UTSW	11	72863989	missense	probably benign	0.00
R8885:Zzef1	UTSW	11	72796576	missense	probably benign	0.00
R8972:Zzef1	UTSW	11	72900673	missense	probably damaging	1.00
R8979:Zzef1	UTSW	11	72875177	missense	probably benign	0.00
R9053:Zzef1	UTSW	11	72922476	missense	probably benign
R9108:Zzef1	UTSW	11	72899778	missense	probably benign	0.11
R9121:Zzef1	UTSW	11	72866120	nonsense	probably null
R9253:Zzef1	UTSW	11	72848637	splice site	probably benign
R9370:Zzef1	UTSW	11	72853322	missense	probably damaging	1.00
R9408:Zzef1	UTSW	11	72864827	missense	possibly damaging	0.86
R9467:Zzef1	UTSW	11	72916425	missense	probably damaging	1.00
R9468:Zzef1	UTSW	11	72923183	critical splice donor site	probably null
R9563:Zzef1	UTSW	11	72874906	missense	probably damaging	1.00
R9647:Zzef1	UTSW	11	72869825	missense	probably benign	0.01
R9667:Zzef1	UTSW	11	72867960	missense	probably benign
R9742:Zzef1	UTSW	11	72858353	missense	probably benign
X0028:Zzef1	UTSW	11	72906979	missense	probably benign	0.29
Z1176:Zzef1	UTSW	11	72796528	missense	probably damaging	1.00
Z1177:Zzef1	UTSW	11	72796312	missense	possibly damaging	0.91
Z1177:Zzef1	UTSW	11	72826178	missense	probably damaging	1.00
Z1177:Zzef1	UTSW	11	72900631	critical splice acceptor site	probably null
Z1177:Zzef1	UTSW	11	72915320	missense	probably damaging	1.00
Z1186:Zzef1	UTSW	11	72889182	missense	probably benign
Z1187:Zzef1	UTSW	11	72889182	missense	probably benign
Z1188:Zzef1	UTSW	11	72889182	missense	probably benign
Z1189:Zzef1	UTSW	11	72889182	missense	probably benign
Z1190:Zzef1	UTSW	11	72889182	missense	probably benign
Z1191:Zzef1	UTSW	11	72889182	missense	probably benign
Z1192:Zzef1	UTSW	11	72889182	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGGGAACTTGGTTATCCAGTCTC -3'
(R):5'- ACTCAAGTTTGCCAATGAACCAG -3'

Sequencing Primer
(F):5'- AGTCTCAAATCCTAGCAAGTGG -3'
(R):5'- GAGACTCTACATAGCACAGTGAGTC -3'

Posted On

2019-06-26