Incidental Mutation 'R7284:Bhlha9'
ID565885
Institutional Source Beutler Lab
Gene Symbol Bhlha9
Ensembl Gene ENSMUSG00000044243
Gene Namebasic helix-loop-helix family, member a9
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7284 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location76672470-76673676 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 76672666 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 40 (S40G)
Ref Sequence ENSEMBL: ENSMUSP00000050516 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056184]
Predicted Effect probably benign
Transcript: ENSMUST00000056184
AA Change: S40G

PolyPhen 2 Score 0.037 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000050516
Gene: ENSMUSG00000044243
AA Change: S40G

DomainStartEndE-ValueType
low complexity region 7 13 N/A INTRINSIC
low complexity region 44 49 N/A INTRINSIC
HLH 67 119 3.66e-8 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the basic helix-loop-helix family. The encoded protein is a transcription factor involved in limb development. Mutations in this gene have been associated with mesoaxial synostotic syndactyly Malik-Percin type (MSSD). Copy number variation of a locus containing this gene has been linked to a form of split-hand/foot malformation with long bone deficiency (SHFLD3). [provided by RefSeq, Mar 2015]
PHENOTYPE: Mice homozygous for a null allele exhibit variable asymmetrical syndactyly and interdigital webbing due to reduced interdigital apoptosis and incomplete separation of soft, but not skeletal, tissues between forelimb digits 2 and 3. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,734,583 H942Q probably benign Het
2900092C05Rik G T 7: 12,512,678 E34* probably null Het
4933421I07Rik C T 7: 42,447,980 R30H probably damaging Het
AB124611 C A 9: 21,539,104 Q158K probably benign Het
Abcc3 C T 11: 94,357,047 A1207T probably benign Het
Abcc9 A T 6: 142,682,917 L367Q probably damaging Het
Aftph T C 11: 20,726,812 K266E probably benign Het
Akap9 T A 5: 3,956,246 D190E probably damaging Het
Angel1 G T 12: 86,720,524 D359E probably damaging Het
Ano6 T C 15: 95,948,303 I474T probably damaging Het
Atp2c1 A T 9: 105,520,809 probably null Het
Best1 T C 19: 9,986,373 probably null Het
Cabin1 G A 10: 75,694,834 R178C Het
Ccnb1ip1 A G 14: 50,792,279 Y109H probably damaging Het
Col14a1 T C 15: 55,518,319 S1763P probably damaging Het
Dars T C 1: 128,372,267 T327A probably benign Het
Dhx8 T C 11: 101,754,822 Y889H probably damaging Het
Dlg4 T A 11: 70,042,082 Y523* probably null Het
Dnah10 A T 5: 124,832,598 D4484V probably benign Het
Dnah9 A T 11: 65,990,476 M2591K probably damaging Het
Dock2 T C 11: 34,230,672 E1715G probably benign Het
Dym A G 18: 75,119,171 Y336C possibly damaging Het
Ezh2 A G 6: 47,544,519 M439T probably benign Het
Folr1 T G 7: 101,859,470 N83H possibly damaging Het
Ganab T C 19: 8,912,540 L656P probably damaging Het
Gmnc T C 16: 26,960,792 H161R probably benign Het
Gria4 A G 9: 4,472,017 Y491H probably damaging Het
Heatr3 T A 8: 88,156,774 C412S possibly damaging Het
Hmgcr A C 13: 96,652,665 V716G probably damaging Het
Igsf9 A G 1: 172,496,912 D799G probably damaging Het
Ikbkb T C 8: 22,668,960 T501A probably benign Het
Kbtbd3 C T 9: 4,330,690 R355* probably null Het
Kcna7 T A 7: 45,409,228 I313N probably damaging Het
Kirrel A C 3: 87,083,387 D709E probably benign Het
Klb T A 5: 65,383,478 S971R probably benign Het
Krtap4-13 A T 11: 99,809,412 C140* probably null Het
Lacc1 A T 14: 77,030,869 L334Q probably damaging Het
Map6d1 T A 16: 20,241,025 R97* probably null Het
Mgat5b T C 11: 116,944,920 S129P probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Myh9 G A 15: 77,787,596 R432C probably damaging Het
Ncf4 A G 15: 78,260,702 T236A probably benign Het
Neb T C 2: 52,258,792 D2581G probably damaging Het
Nid1 T A 13: 13,489,090 M778K probably benign Het
Npas2 A G 1: 39,324,467 D209G probably benign Het
Nploc4 C T 11: 120,416,370 V181I possibly damaging Het
Nrcam A T 12: 44,564,034 I506F probably damaging Het
Olfr197 A G 16: 59,185,968 *172Q probably null Het
Olfr692 T A 7: 105,368,545 M73K probably damaging Het
Olfr803 T C 10: 129,691,351 N230S probably benign Het
Pask T A 1: 93,320,669 Q970L probably benign Het
Pfkfb4 T C 9: 109,011,240 I308T possibly damaging Het
Pla2g4d A T 2: 120,284,136 L38Q probably damaging Het
Pld1 A G 3: 28,131,733 T1036A possibly damaging Het
Pom121l2 A G 13: 21,982,605 T349A probably damaging Het
Ppp1r13b A G 12: 111,834,966 I551T possibly damaging Het
Prps1l1 A G 12: 34,985,318 N144S possibly damaging Het
Prss56 A G 1: 87,185,401 N179S probably null Het
Prune2 T C 19: 17,119,886 L918P probably damaging Het
Ptprz1 C T 6: 23,000,098 T729I probably damaging Het
Rrp7a T C 15: 83,121,870 T60A probably damaging Het
Snx27 A G 3: 94,524,191 Y299H probably damaging Het
Spaca3 G T 11: 80,864,021 R96L possibly damaging Het
Stat1 A G 1: 52,148,922 N495S probably benign Het
Tas2r130 T C 6: 131,630,307 N175S probably benign Het
Tcaf2 A G 6: 42,629,538 L494P probably damaging Het
Tdrd12 C A 7: 35,480,136 probably null Het
Thbs1 A G 2: 118,119,356 N604S probably damaging Het
Togaram1 T C 12: 65,008,680 F1482L probably benign Het
Trhr2 A T 8: 122,360,375 S109T probably damaging Het
Trpc3 A T 3: 36,624,413 M841K probably damaging Het
Tubgcp5 C T 7: 55,823,567 R798C probably benign Het
Xirp2 T A 2: 67,516,829 M3138K probably benign Het
Zdhhc4 G A 5: 143,321,891 T125I probably benign Het
Zfp239 T A 6: 117,871,755 C151* probably null Het
Zfp473 C T 7: 44,733,203 E569K not run Het
Zzef1 T A 11: 72,886,690 D1782E probably damaging Het
Other mutations in Bhlha9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01883:Bhlha9 APN 11 76673098 missense probably benign 0.13
IGL02998:Bhlha9 APN 11 76672744 missense probably damaging 1.00
R1537:Bhlha9 UTSW 11 76672631 missense probably benign
R2908:Bhlha9 UTSW 11 76672607 missense probably benign 0.00
R5576:Bhlha9 UTSW 11 76672769 missense probably damaging 1.00
R7728:Bhlha9 UTSW 11 76673089 missense possibly damaging 0.49
R8220:Bhlha9 UTSW 11 76672877 missense probably damaging 1.00
V1662:Bhlha9 UTSW 11 76673036 missense probably benign 0.30
Predicted Primers PCR Primer
(F):5'- TAAAGCCCAGCTAGAGAGGACC -3'
(R):5'- ATCTTGGAGAGCCTCTTGCC -3'

Sequencing Primer
(F):5'- CATCAGTCAGTGGACCAGCAG -3'
(R):5'- TTGCCTCCGAGGTCATGCTG -3'
Posted On2019-06-26