Incidental Mutation 'R7284:Pom121l2'
ID565898
Institutional Source Beutler Lab
Gene Symbol Pom121l2
Ensembl Gene ENSMUSG00000016982
Gene NamePOM121 membrane glycoprotein-like 2 (rat)
SynonymsLOC195236
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R7284 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location21981194-21988734 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 21982605 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 349 (T349A)
Ref Sequence ENSEMBL: ENSMUSP00000113688 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017126] [ENSMUST00000117882]
Predicted Effect probably damaging
Transcript: ENSMUST00000017126
AA Change: T349A

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000017126
Gene: ENSMUSG00000016982
AA Change: T349A

DomainStartEndE-ValueType
low complexity region 42 60 N/A INTRINSIC
Pfam:POM121 162 301 3.5e-24 PFAM
low complexity region 367 379 N/A INTRINSIC
low complexity region 413 433 N/A INTRINSIC
low complexity region 517 526 N/A INTRINSIC
low complexity region 558 572 N/A INTRINSIC
low complexity region 697 712 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117882
AA Change: T349A

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113688
Gene: ENSMUSG00000016982
AA Change: T349A

DomainStartEndE-ValueType
low complexity region 42 60 N/A INTRINSIC
Pfam:POM121 162 301 2e-24 PFAM
low complexity region 367 379 N/A INTRINSIC
low complexity region 413 433 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 99% (77/78)
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,734,583 H942Q probably benign Het
2900092C05Rik G T 7: 12,512,678 E34* probably null Het
4933421I07Rik C T 7: 42,447,980 R30H probably damaging Het
AB124611 C A 9: 21,539,104 Q158K probably benign Het
Abcc3 C T 11: 94,357,047 A1207T probably benign Het
Abcc9 A T 6: 142,682,917 L367Q probably damaging Het
Aftph T C 11: 20,726,812 K266E probably benign Het
Akap9 T A 5: 3,956,246 D190E probably damaging Het
Angel1 G T 12: 86,720,524 D359E probably damaging Het
Ano6 T C 15: 95,948,303 I474T probably damaging Het
Atp2c1 A T 9: 105,520,809 probably null Het
Best1 T C 19: 9,986,373 probably null Het
Bhlha9 A G 11: 76,672,666 S40G probably benign Het
Cabin1 G A 10: 75,694,834 R178C Het
Ccnb1ip1 A G 14: 50,792,279 Y109H probably damaging Het
Col14a1 T C 15: 55,518,319 S1763P probably damaging Het
Dars T C 1: 128,372,267 T327A probably benign Het
Dhx8 T C 11: 101,754,822 Y889H probably damaging Het
Dlg4 T A 11: 70,042,082 Y523* probably null Het
Dnah10 A T 5: 124,832,598 D4484V probably benign Het
Dnah9 A T 11: 65,990,476 M2591K probably damaging Het
Dock2 T C 11: 34,230,672 E1715G probably benign Het
Dym A G 18: 75,119,171 Y336C possibly damaging Het
Ezh2 A G 6: 47,544,519 M439T probably benign Het
Folr1 T G 7: 101,859,470 N83H possibly damaging Het
Ganab T C 19: 8,912,540 L656P probably damaging Het
Gmnc T C 16: 26,960,792 H161R probably benign Het
Gria4 A G 9: 4,472,017 Y491H probably damaging Het
Heatr3 T A 8: 88,156,774 C412S possibly damaging Het
Hmgcr A C 13: 96,652,665 V716G probably damaging Het
Igsf9 A G 1: 172,496,912 D799G probably damaging Het
Ikbkb T C 8: 22,668,960 T501A probably benign Het
Kbtbd3 C T 9: 4,330,690 R355* probably null Het
Kcna7 T A 7: 45,409,228 I313N probably damaging Het
Kirrel A C 3: 87,083,387 D709E probably benign Het
Klb T A 5: 65,383,478 S971R probably benign Het
Krtap4-13 A T 11: 99,809,412 C140* probably null Het
Lacc1 A T 14: 77,030,869 L334Q probably damaging Het
Map6d1 T A 16: 20,241,025 R97* probably null Het
Mgat5b T C 11: 116,944,920 S129P probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Myh9 G A 15: 77,787,596 R432C probably damaging Het
Ncf4 A G 15: 78,260,702 T236A probably benign Het
Neb T C 2: 52,258,792 D2581G probably damaging Het
Nid1 T A 13: 13,489,090 M778K probably benign Het
Npas2 A G 1: 39,324,467 D209G probably benign Het
Nploc4 C T 11: 120,416,370 V181I possibly damaging Het
Nrcam A T 12: 44,564,034 I506F probably damaging Het
Olfr197 A G 16: 59,185,968 *172Q probably null Het
Olfr692 T A 7: 105,368,545 M73K probably damaging Het
Olfr803 T C 10: 129,691,351 N230S probably benign Het
Pask T A 1: 93,320,669 Q970L probably benign Het
Pfkfb4 T C 9: 109,011,240 I308T possibly damaging Het
Pla2g4d A T 2: 120,284,136 L38Q probably damaging Het
Pld1 A G 3: 28,131,733 T1036A possibly damaging Het
Ppp1r13b A G 12: 111,834,966 I551T possibly damaging Het
Prps1l1 A G 12: 34,985,318 N144S possibly damaging Het
Prss56 A G 1: 87,185,401 N179S probably null Het
Prune2 T C 19: 17,119,886 L918P probably damaging Het
Ptprz1 C T 6: 23,000,098 T729I probably damaging Het
Rrp7a T C 15: 83,121,870 T60A probably damaging Het
Snx27 A G 3: 94,524,191 Y299H probably damaging Het
Spaca3 G T 11: 80,864,021 R96L possibly damaging Het
Stat1 A G 1: 52,148,922 N495S probably benign Het
Tas2r130 T C 6: 131,630,307 N175S probably benign Het
Tcaf2 A G 6: 42,629,538 L494P probably damaging Het
Tdrd12 C A 7: 35,480,136 probably null Het
Thbs1 A G 2: 118,119,356 N604S probably damaging Het
Togaram1 T C 12: 65,008,680 F1482L probably benign Het
Trhr2 A T 8: 122,360,375 S109T probably damaging Het
Trpc3 A T 3: 36,624,413 M841K probably damaging Het
Tubgcp5 C T 7: 55,823,567 R798C probably benign Het
Xirp2 T A 2: 67,516,829 M3138K probably benign Het
Zdhhc4 G A 5: 143,321,891 T125I probably benign Het
Zfp239 T A 6: 117,871,755 C151* probably null Het
Zfp473 C T 7: 44,733,203 E569K not run Het
Zzef1 T A 11: 72,886,690 D1782E probably damaging Het
Other mutations in Pom121l2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02104:Pom121l2 APN 13 21982275 missense possibly damaging 0.70
IGL02223:Pom121l2 APN 13 21982095 missense probably benign 0.01
R0401:Pom121l2 UTSW 13 21982225 missense probably benign 0.01
R0402:Pom121l2 UTSW 13 21988479 splice site probably benign
R0437:Pom121l2 UTSW 13 21983205 missense possibly damaging 0.72
R0575:Pom121l2 UTSW 13 21984168 missense probably damaging 0.99
R0605:Pom121l2 UTSW 13 21982036 missense probably damaging 1.00
R0892:Pom121l2 UTSW 13 21982474 missense possibly damaging 0.49
R0992:Pom121l2 UTSW 13 21982759 missense probably benign 0.01
R1259:Pom121l2 UTSW 13 21982127 nonsense probably null
R1564:Pom121l2 UTSW 13 21983353 missense possibly damaging 0.86
R1603:Pom121l2 UTSW 13 21983344 missense probably damaging 1.00
R1836:Pom121l2 UTSW 13 21983784 missense probably benign 0.03
R1970:Pom121l2 UTSW 13 21983472 missense probably damaging 0.98
R2018:Pom121l2 UTSW 13 21982734 missense possibly damaging 0.54
R2180:Pom121l2 UTSW 13 21981975 missense probably benign 0.08
R2277:Pom121l2 UTSW 13 21984247 missense probably benign
R2365:Pom121l2 UTSW 13 21983784 missense probably benign 0.20
R3951:Pom121l2 UTSW 13 21982128 missense probably damaging 1.00
R4371:Pom121l2 UTSW 13 21982239 missense probably benign 0.01
R4574:Pom121l2 UTSW 13 21984402 missense probably benign 0.02
R4593:Pom121l2 UTSW 13 21984453 missense probably damaging 1.00
R4983:Pom121l2 UTSW 13 21983814 missense probably benign 0.02
R5320:Pom121l2 UTSW 13 21981845 nonsense probably null
R5661:Pom121l2 UTSW 13 21984255 missense possibly damaging 0.90
R5662:Pom121l2 UTSW 13 21982188 missense probably benign 0.01
R5908:Pom121l2 UTSW 13 21981814 missense probably damaging 0.99
R5980:Pom121l2 UTSW 13 21983376 missense probably damaging 0.96
R6145:Pom121l2 UTSW 13 21982302 nonsense probably null
R6160:Pom121l2 UTSW 13 21983668 missense possibly damaging 0.52
R6327:Pom121l2 UTSW 13 21982332 missense probably damaging 1.00
R6504:Pom121l2 UTSW 13 21983461 missense possibly damaging 0.55
R6745:Pom121l2 UTSW 13 21983698 missense probably benign 0.00
R6750:Pom121l2 UTSW 13 21981937 missense probably damaging 1.00
R6752:Pom121l2 UTSW 13 21981769 missense probably damaging 0.99
R6796:Pom121l2 UTSW 13 21983524 missense probably benign 0.09
R6984:Pom121l2 UTSW 13 21982021 missense probably benign 0.33
R7287:Pom121l2 UTSW 13 21984332 missense probably benign 0.16
R7568:Pom121l2 UTSW 13 21982626 missense probably benign 0.03
R7624:Pom121l2 UTSW 13 21983529 missense probably damaging 0.97
R7832:Pom121l2 UTSW 13 21983878 missense possibly damaging 0.49
R7956:Pom121l2 UTSW 13 21983146 missense probably damaging 1.00
R8103:Pom121l2 UTSW 13 21982374 missense probably benign 0.00
Z1177:Pom121l2 UTSW 13 21988486 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- TAGTCCAGACTCCAGAATGGCC -3'
(R):5'- CCTTGGATGTGCTCTAACTGTG -3'

Sequencing Primer
(F):5'- GGAGAGAGTCCTAATTCTCACCTC -3'
(R):5'- GATGTGCTCTAACTGTGAGCACC -3'
Posted On2019-06-26