Incidental Mutation 'R7284:Myh9'
ID565903
Institutional Source Beutler Lab
Gene Symbol Myh9
Ensembl Gene ENSMUSG00000022443
Gene Namemyosin, heavy polypeptide 9, non-muscle
SynonymsNMHC II-A, D0Jmb2, myosin IIA, Fltn, Myhn1, Myhn-1, E030044M24Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7284 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location77760587-77842175 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 77787596 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 432 (R432C)
Ref Sequence ENSEMBL: ENSMUSP00000016771 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016771] [ENSMUST00000123101]
Predicted Effect probably damaging
Transcript: ENSMUST00000016771
AA Change: R432C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000016771
Gene: ENSMUSG00000022443
AA Change: R432C

DomainStartEndE-ValueType
Pfam:Myosin_N 29 69 3.4e-11 PFAM
MYSc 75 777 N/A SMART
IQ 778 800 1.46e-3 SMART
Pfam:Myosin_tail_1 841 1921 N/A PFAM
low complexity region 1948 1959 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000123101
SMART Domains Protein: ENSMUSP00000116198
Gene: ENSMUSG00000022443

DomainStartEndE-ValueType
Pfam:Myosin_N 29 71 6.8e-15 PFAM
Pfam:Myosin_head 83 114 5.9e-8 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a conventional non-muscle myosin; this protein should not be confused with the unconventional myosin-9a or 9b (MYO9A or MYO9B). The encoded protein is a myosin IIA heavy chain that contains an IQ domain and a myosin head-like domain which is involved in several important functions, including cytokinesis, cell motility and maintenance of cell shape. Defects in this gene have been associated with non-syndromic sensorineural deafness autosomal dominant type 17, Epstein syndrome, Alport syndrome with macrothrombocytopenia, Sebastian syndrome, Fechtner syndrome and macrothrombocytopenia with progressive sensorineural deafness. [provided by RefSeq, Dec 2011]
PHENOTYPE: Homozygous null mice display embryonic lethality. Heterozygous null mice display hearing loss with incomplete penetrance. Mice homozygous or heterozygous for one of several knock-in alleles exhibit macrothrombocytopenia, nephritis, cataracts and deafness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,734,583 H942Q probably benign Het
2900092C05Rik G T 7: 12,512,678 E34* probably null Het
4933421I07Rik C T 7: 42,447,980 R30H probably damaging Het
AB124611 C A 9: 21,539,104 Q158K probably benign Het
Abcc3 C T 11: 94,357,047 A1207T probably benign Het
Abcc9 A T 6: 142,682,917 L367Q probably damaging Het
Aftph T C 11: 20,726,812 K266E probably benign Het
Akap9 T A 5: 3,956,246 D190E probably damaging Het
Angel1 G T 12: 86,720,524 D359E probably damaging Het
Ano6 T C 15: 95,948,303 I474T probably damaging Het
Atp2c1 A T 9: 105,520,809 probably null Het
Best1 T C 19: 9,986,373 probably null Het
Bhlha9 A G 11: 76,672,666 S40G probably benign Het
Cabin1 G A 10: 75,694,834 R178C Het
Ccnb1ip1 A G 14: 50,792,279 Y109H probably damaging Het
Col14a1 T C 15: 55,518,319 S1763P probably damaging Het
Dars T C 1: 128,372,267 T327A probably benign Het
Dhx8 T C 11: 101,754,822 Y889H probably damaging Het
Dlg4 T A 11: 70,042,082 Y523* probably null Het
Dnah10 A T 5: 124,832,598 D4484V probably benign Het
Dnah9 A T 11: 65,990,476 M2591K probably damaging Het
Dock2 T C 11: 34,230,672 E1715G probably benign Het
Dym A G 18: 75,119,171 Y336C possibly damaging Het
Ezh2 A G 6: 47,544,519 M439T probably benign Het
Folr1 T G 7: 101,859,470 N83H possibly damaging Het
Ganab T C 19: 8,912,540 L656P probably damaging Het
Gmnc T C 16: 26,960,792 H161R probably benign Het
Gria4 A G 9: 4,472,017 Y491H probably damaging Het
Heatr3 T A 8: 88,156,774 C412S possibly damaging Het
Hmgcr A C 13: 96,652,665 V716G probably damaging Het
Igsf9 A G 1: 172,496,912 D799G probably damaging Het
Ikbkb T C 8: 22,668,960 T501A probably benign Het
Kbtbd3 C T 9: 4,330,690 R355* probably null Het
Kcna7 T A 7: 45,409,228 I313N probably damaging Het
Kirrel A C 3: 87,083,387 D709E probably benign Het
Klb T A 5: 65,383,478 S971R probably benign Het
Krtap4-13 A T 11: 99,809,412 C140* probably null Het
Lacc1 A T 14: 77,030,869 L334Q probably damaging Het
Map6d1 T A 16: 20,241,025 R97* probably null Het
Mgat5b T C 11: 116,944,920 S129P probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Ncf4 A G 15: 78,260,702 T236A probably benign Het
Neb T C 2: 52,258,792 D2581G probably damaging Het
Nid1 T A 13: 13,489,090 M778K probably benign Het
Npas2 A G 1: 39,324,467 D209G probably benign Het
Nploc4 C T 11: 120,416,370 V181I possibly damaging Het
Nrcam A T 12: 44,564,034 I506F probably damaging Het
Olfr197 A G 16: 59,185,968 *172Q probably null Het
Olfr692 T A 7: 105,368,545 M73K probably damaging Het
Olfr803 T C 10: 129,691,351 N230S probably benign Het
Pask T A 1: 93,320,669 Q970L probably benign Het
Pfkfb4 T C 9: 109,011,240 I308T possibly damaging Het
Pla2g4d A T 2: 120,284,136 L38Q probably damaging Het
Pld1 A G 3: 28,131,733 T1036A possibly damaging Het
Pom121l2 A G 13: 21,982,605 T349A probably damaging Het
Ppp1r13b A G 12: 111,834,966 I551T possibly damaging Het
Prps1l1 A G 12: 34,985,318 N144S possibly damaging Het
Prss56 A G 1: 87,185,401 N179S probably null Het
Prune2 T C 19: 17,119,886 L918P probably damaging Het
Ptprz1 C T 6: 23,000,098 T729I probably damaging Het
Rrp7a T C 15: 83,121,870 T60A probably damaging Het
Snx27 A G 3: 94,524,191 Y299H probably damaging Het
Spaca3 G T 11: 80,864,021 R96L possibly damaging Het
Stat1 A G 1: 52,148,922 N495S probably benign Het
Tas2r130 T C 6: 131,630,307 N175S probably benign Het
Tcaf2 A G 6: 42,629,538 L494P probably damaging Het
Tdrd12 C A 7: 35,480,136 probably null Het
Thbs1 A G 2: 118,119,356 N604S probably damaging Het
Togaram1 T C 12: 65,008,680 F1482L probably benign Het
Trhr2 A T 8: 122,360,375 S109T probably damaging Het
Trpc3 A T 3: 36,624,413 M841K probably damaging Het
Tubgcp5 C T 7: 55,823,567 R798C probably benign Het
Xirp2 T A 2: 67,516,829 M3138K probably benign Het
Zdhhc4 G A 5: 143,321,891 T125I probably benign Het
Zfp239 T A 6: 117,871,755 C151* probably null Het
Zfp473 C T 7: 44,733,203 E569K not run Het
Zzef1 T A 11: 72,886,690 D1782E probably damaging Het
Other mutations in Myh9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00796:Myh9 APN 15 77796995 splice site probably benign
IGL01105:Myh9 APN 15 77781478 missense probably benign 0.01
IGL01137:Myh9 APN 15 77769542 missense probably benign 0.19
IGL01399:Myh9 APN 15 77767270 missense probably damaging 1.00
IGL01666:Myh9 APN 15 77761931 missense probably benign 0.31
IGL01832:Myh9 APN 15 77791753 missense probably benign 0.02
IGL01933:Myh9 APN 15 77781218 missense probably benign 0.00
IGL02049:Myh9 APN 15 77769870 missense probably benign 0.01
IGL02237:Myh9 APN 15 77786654 missense probably benign 0.03
IGL02243:Myh9 APN 15 77767482 missense probably damaging 1.00
IGL02248:Myh9 APN 15 77786614 missense probably damaging 0.99
IGL02292:Myh9 APN 15 77807996 missense probably damaging 1.00
IGL02315:Myh9 APN 15 77769973 missense probably benign 0.00
IGL02427:Myh9 APN 15 77775804 missense probably damaging 0.98
IGL02675:Myh9 APN 15 77788930 missense possibly damaging 0.89
IGL02727:Myh9 APN 15 77791742 missense probably benign 0.11
IGL02749:Myh9 APN 15 77807986 nonsense probably null
IGL02887:Myh9 APN 15 77796020 nonsense probably null
IGL02926:Myh9 APN 15 77787626 missense probably damaging 1.00
IGL02945:Myh9 APN 15 77762005 missense probably benign 0.05
IGL03137:Myh9 APN 15 77791089 missense probably damaging 1.00
R0784:Myh9 UTSW 15 77777009 splice site probably benign
R1375:Myh9 UTSW 15 77769368 splice site probably null
R1535:Myh9 UTSW 15 77777813 missense probably damaging 0.98
R1563:Myh9 UTSW 15 77771857 missense probably damaging 0.99
R1629:Myh9 UTSW 15 77764401 missense probably damaging 1.00
R1635:Myh9 UTSW 15 77771167 missense probably benign 0.06
R1635:Myh9 UTSW 15 77775899 missense probably benign 0.00
R1693:Myh9 UTSW 15 77812897 missense probably damaging 1.00
R1791:Myh9 UTSW 15 77773264 unclassified probably benign
R2010:Myh9 UTSW 15 77771947 missense probably benign 0.06
R2048:Myh9 UTSW 15 77771132 missense possibly damaging 0.70
R2078:Myh9 UTSW 15 77763912 missense probably benign 0.16
R2092:Myh9 UTSW 15 77764350 nonsense probably null
R2376:Myh9 UTSW 15 77783417 missense probably benign 0.18
R2922:Myh9 UTSW 15 77813184 missense probably damaging 1.00
R3709:Myh9 UTSW 15 77773347 missense possibly damaging 0.84
R3710:Myh9 UTSW 15 77773347 missense possibly damaging 0.84
R3737:Myh9 UTSW 15 77766812 missense probably damaging 0.99
R3738:Myh9 UTSW 15 77766812 missense probably damaging 0.99
R3739:Myh9 UTSW 15 77766812 missense probably damaging 0.99
R4299:Myh9 UTSW 15 77769964 missense probably benign
R4384:Myh9 UTSW 15 77791712 splice site probably benign
R4514:Myh9 UTSW 15 77764000 missense probably benign
R4631:Myh9 UTSW 15 77797028 missense probably damaging 0.99
R4642:Myh9 UTSW 15 77761951 missense probably benign 0.10
R4695:Myh9 UTSW 15 77768853 missense probably damaging 0.99
R4709:Myh9 UTSW 15 77787517 missense probably damaging 1.00
R4766:Myh9 UTSW 15 77807877 missense probably damaging 0.97
R4826:Myh9 UTSW 15 77788946 nonsense probably null
R4842:Myh9 UTSW 15 77769253 missense probably damaging 0.99
R4946:Myh9 UTSW 15 77773340 missense probably damaging 1.00
R5030:Myh9 UTSW 15 77807798 intron probably benign
R5055:Myh9 UTSW 15 77764523 missense probably benign 0.12
R5202:Myh9 UTSW 15 77781110 critical splice donor site probably null
R5413:Myh9 UTSW 15 77807986 nonsense probably null
R5435:Myh9 UTSW 15 77769609 missense probably benign 0.00
R5701:Myh9 UTSW 15 77791764 missense probably benign 0.00
R5757:Myh9 UTSW 15 77771162 missense probably benign 0.44
R5793:Myh9 UTSW 15 77768877 missense probably benign 0.23
R5952:Myh9 UTSW 15 77773332 missense possibly damaging 0.65
R6248:Myh9 UTSW 15 77785222 nonsense probably null
R6648:Myh9 UTSW 15 77766772 missense probably benign 0.08
R7055:Myh9 UTSW 15 77775198 missense probably damaging 1.00
R7106:Myh9 UTSW 15 77775121 missense probably benign
R7180:Myh9 UTSW 15 77807910 missense probably benign 0.00
R7205:Myh9 UTSW 15 77783472 missense probably benign 0.08
R7254:Myh9 UTSW 15 77765824 missense probably damaging 1.00
R7417:Myh9 UTSW 15 77763865 nonsense probably null
R7695:Myh9 UTSW 15 77766736 missense probably benign 0.31
R7750:Myh9 UTSW 15 77783410 missense probably benign 0.01
R7854:Myh9 UTSW 15 77791753 missense probably benign 0.02
R8220:Myh9 UTSW 15 77764547 missense possibly damaging 0.87
R8324:Myh9 UTSW 15 77788917 critical splice donor site probably null
Z1088:Myh9 UTSW 15 77775258 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGATTGCCAGTGTGAGCAG -3'
(R):5'- GGATCTAGAATGCCTTCCCC -3'

Sequencing Primer
(F):5'- AGTGTGAGCAGCCACGG -3'
(R):5'- CATCTTCCATGCCTAGGCTG -3'
Posted On2019-06-26