Incidental Mutation 'R7284:Dym'
ID565911
Institutional Source Beutler Lab
Gene Symbol Dym
Ensembl Gene ENSMUSG00000035765
Gene Namedymeclin
SynonymsC030019K18Rik, 4933427L07Rik, 1810041M12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7284 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location75018772-75286966 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75119171 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 336 (Y336C)
Ref Sequence ENSEMBL: ENSMUSP00000047054 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039608]
Predicted Effect possibly damaging
Transcript: ENSMUST00000039608
AA Change: Y336C

PolyPhen 2 Score 0.600 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000047054
Gene: ENSMUSG00000035765
AA Change: Y336C

DomainStartEndE-ValueType
Pfam:Dymeclin 1 646 3.3e-174 PFAM
Pfam:Hid1 309 584 3e-11 PFAM
Meta Mutation Damage Score 0.9035 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.3%
Validation Efficiency 99% (77/78)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which is necessary for normal skeletal development and brain function. Mutations in this gene are associated with two types of recessive osteochondrodysplasia, Dyggve-Melchior-Clausen (DMC) dysplasia and Smith-McCort (SMC) dysplasia, which involve both skeletal defects and mental retardation. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele display decreased body size with short tubular bones, chondrodysplasia, partial penetrance of obstructive hydronephrosis and impaired vesicular transport. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 77 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,734,583 H942Q probably benign Het
2900092C05Rik G T 7: 12,512,678 E34* probably null Het
4933421I07Rik C T 7: 42,447,980 R30H probably damaging Het
AB124611 C A 9: 21,539,104 Q158K probably benign Het
Abcc3 C T 11: 94,357,047 A1207T probably benign Het
Abcc9 A T 6: 142,682,917 L367Q probably damaging Het
Aftph T C 11: 20,726,812 K266E probably benign Het
Akap9 T A 5: 3,956,246 D190E probably damaging Het
Angel1 G T 12: 86,720,524 D359E probably damaging Het
Ano6 T C 15: 95,948,303 I474T probably damaging Het
Atp2c1 A T 9: 105,520,809 probably null Het
Best1 T C 19: 9,986,373 probably null Het
Bhlha9 A G 11: 76,672,666 S40G probably benign Het
Cabin1 G A 10: 75,694,834 R178C Het
Ccnb1ip1 A G 14: 50,792,279 Y109H probably damaging Het
Col14a1 T C 15: 55,518,319 S1763P probably damaging Het
Dars T C 1: 128,372,267 T327A probably benign Het
Dhx8 T C 11: 101,754,822 Y889H probably damaging Het
Dlg4 T A 11: 70,042,082 Y523* probably null Het
Dnah10 A T 5: 124,832,598 D4484V probably benign Het
Dnah9 A T 11: 65,990,476 M2591K probably damaging Het
Dock2 T C 11: 34,230,672 E1715G probably benign Het
Ezh2 A G 6: 47,544,519 M439T probably benign Het
Folr1 T G 7: 101,859,470 N83H possibly damaging Het
Ganab T C 19: 8,912,540 L656P probably damaging Het
Gmnc T C 16: 26,960,792 H161R probably benign Het
Gria4 A G 9: 4,472,017 Y491H probably damaging Het
Heatr3 T A 8: 88,156,774 C412S possibly damaging Het
Hmgcr A C 13: 96,652,665 V716G probably damaging Het
Igsf9 A G 1: 172,496,912 D799G probably damaging Het
Ikbkb T C 8: 22,668,960 T501A probably benign Het
Kbtbd3 C T 9: 4,330,690 R355* probably null Het
Kcna7 T A 7: 45,409,228 I313N probably damaging Het
Kirrel A C 3: 87,083,387 D709E probably benign Het
Klb T A 5: 65,383,478 S971R probably benign Het
Krtap4-13 A T 11: 99,809,412 C140* probably null Het
Lacc1 A T 14: 77,030,869 L334Q probably damaging Het
Map6d1 T A 16: 20,241,025 R97* probably null Het
Mgat5b T C 11: 116,944,920 S129P probably damaging Het
Mmp1a TG TGG 9: 7,465,083 probably null Het
Myh9 G A 15: 77,787,596 R432C probably damaging Het
Ncf4 A G 15: 78,260,702 T236A probably benign Het
Neb T C 2: 52,258,792 D2581G probably damaging Het
Nid1 T A 13: 13,489,090 M778K probably benign Het
Npas2 A G 1: 39,324,467 D209G probably benign Het
Nploc4 C T 11: 120,416,370 V181I possibly damaging Het
Nrcam A T 12: 44,564,034 I506F probably damaging Het
Olfr197 A G 16: 59,185,968 *172Q probably null Het
Olfr692 T A 7: 105,368,545 M73K probably damaging Het
Olfr803 T C 10: 129,691,351 N230S probably benign Het
Pask T A 1: 93,320,669 Q970L probably benign Het
Pfkfb4 T C 9: 109,011,240 I308T possibly damaging Het
Pla2g4d A T 2: 120,284,136 L38Q probably damaging Het
Pld1 A G 3: 28,131,733 T1036A possibly damaging Het
Pom121l2 A G 13: 21,982,605 T349A probably damaging Het
Ppp1r13b A G 12: 111,834,966 I551T possibly damaging Het
Prps1l1 A G 12: 34,985,318 N144S possibly damaging Het
Prss56 A G 1: 87,185,401 N179S probably null Het
Prune2 T C 19: 17,119,886 L918P probably damaging Het
Ptprz1 C T 6: 23,000,098 T729I probably damaging Het
Rrp7a T C 15: 83,121,870 T60A probably damaging Het
Snx27 A G 3: 94,524,191 Y299H probably damaging Het
Spaca3 G T 11: 80,864,021 R96L possibly damaging Het
Stat1 A G 1: 52,148,922 N495S probably benign Het
Tas2r130 T C 6: 131,630,307 N175S probably benign Het
Tcaf2 A G 6: 42,629,538 L494P probably damaging Het
Tdrd12 C A 7: 35,480,136 probably null Het
Thbs1 A G 2: 118,119,356 N604S probably damaging Het
Togaram1 T C 12: 65,008,680 F1482L probably benign Het
Trhr2 A T 8: 122,360,375 S109T probably damaging Het
Trpc3 A T 3: 36,624,413 M841K probably damaging Het
Tubgcp5 C T 7: 55,823,567 R798C probably benign Het
Xirp2 T A 2: 67,516,829 M3138K probably benign Het
Zdhhc4 G A 5: 143,321,891 T125I probably benign Het
Zfp239 T A 6: 117,871,755 C151* probably null Het
Zfp473 C T 7: 44,733,203 E569K not run Het
Zzef1 T A 11: 72,886,690 D1782E probably damaging Het
Other mutations in Dym
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00596:Dym APN 18 75119249 missense probably benign 0.43
IGL01593:Dym APN 18 75114781 splice site probably benign
IGL02657:Dym APN 18 75082456 nonsense probably null
IGL02716:Dym APN 18 75286683 missense probably damaging 1.00
IGL02977:Dym APN 18 75063175 critical splice donor site probably null
asesino UTSW 18 75056641 missense probably damaging 1.00
flavor UTSW 18 75056738 nonsense probably null
geschmack UTSW 18 75063174 critical splice donor site probably null
sabor UTSW 18 75125539 critical splice donor site probably null
R0042:Dym UTSW 18 75125539 critical splice donor site probably null
R0058:Dym UTSW 18 75043172 missense possibly damaging 0.94
R0058:Dym UTSW 18 75043172 missense possibly damaging 0.94
R0320:Dym UTSW 18 75199262 missense probably damaging 0.99
R0943:Dym UTSW 18 75286769 makesense probably null
R1677:Dym UTSW 18 75125512 missense probably damaging 1.00
R2022:Dym UTSW 18 75080250 missense probably benign 0.05
R2221:Dym UTSW 18 75230165 missense probably damaging 1.00
R2292:Dym UTSW 18 75199212 missense possibly damaging 0.95
R4087:Dym UTSW 18 75230101 missense probably damaging 1.00
R4929:Dym UTSW 18 75243286 missense probably damaging 1.00
R5033:Dym UTSW 18 75119161 missense possibly damaging 0.78
R6489:Dym UTSW 18 75080226 missense probably benign 0.27
R6641:Dym UTSW 18 75056641 missense probably damaging 1.00
R6751:Dym UTSW 18 75286647 missense probably damaging 0.98
R6864:Dym UTSW 18 75056738 nonsense probably null
R7319:Dym UTSW 18 75063174 critical splice donor site probably null
R8095:Dym UTSW 18 75114801 missense possibly damaging 0.75
Predicted Primers PCR Primer
(F):5'- CAGTGCTTCAGTTGTGGCTTAC -3'
(R):5'- CTGGGGACATTTCTCATCTGTC -3'

Sequencing Primer
(F):5'- GCTTACAGTTTGAAGTGCTGTAACC -3'
(R):5'- ACTCTGAGCCTCTTGGGAAAG -3'
Posted On2019-06-26