Incidental Mutation 'R7285:Lypla1'
ID565915
Institutional Source Beutler Lab
Gene Symbol Lypla1
Ensembl Gene ENSMUSG00000025903
Gene Namelysophospholipase 1
SynonymsPla1a
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7285 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location4807788-4848410 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4841098 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 202 (I202T)
Ref Sequence ENSEMBL: ENSMUSP00000027036 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027036] [ENSMUST00000115529] [ENSMUST00000119612] [ENSMUST00000131119] [ENSMUST00000134384] [ENSMUST00000137887] [ENSMUST00000150971] [ENSMUST00000155020]
Predicted Effect probably benign
Transcript: ENSMUST00000027036
AA Change: I202T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000027036
Gene: ENSMUSG00000025903
AA Change: I202T

DomainStartEndE-ValueType
Pfam:Abhydrolase_2 8 226 2.5e-92 PFAM
Pfam:Abhydrolase_5 23 209 4.3e-14 PFAM
Pfam:Abhydrolase_3 82 170 2.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115529
AA Change: I168T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111191
Gene: ENSMUSG00000025903
AA Change: I168T

DomainStartEndE-ValueType
Pfam:Abhydrolase_2 8 125 1.5e-49 PFAM
Pfam:Abhydrolase_2 122 192 2.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119612
SMART Domains Protein: ENSMUSP00000137647
Gene: ENSMUSG00000025903

DomainStartEndE-ValueType
Pfam:Abhydrolase_2 8 92 1.1e-33 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131119
SMART Domains Protein: ENSMUSP00000118453
Gene: ENSMUSG00000025903

DomainStartEndE-ValueType
Pfam:Abhydrolase_2 1 142 8.1e-56 PFAM
Pfam:Abhydrolase_5 10 141 7.8e-11 PFAM
Pfam:Abhydrolase_6 11 139 9.2e-8 PFAM
Pfam:Abhydrolase_3 20 139 4e-8 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134384
AA Change: I202T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137104
Gene: ENSMUSG00000025903
AA Change: I202T

DomainStartEndE-ValueType
Pfam:Abhydrolase_2 8 224 5.6e-85 PFAM
Pfam:Abhydrolase_5 23 209 4e-14 PFAM
Pfam:Abhydrolase_6 24 160 2.5e-10 PFAM
Pfam:Abhydrolase_3 85 195 2.4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137887
SMART Domains Protein: ENSMUSP00000119456
Gene: ENSMUSG00000025903

DomainStartEndE-ValueType
Pfam:Abhydrolase_2 8 142 5.6e-48 PFAM
Pfam:Abhydrolase_5 23 141 9.3e-10 PFAM
Pfam:Abhydrolase_6 24 141 7.2e-12 PFAM
Pfam:Abhydrolase_3 62 140 2.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000150971
AA Change: I202T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000137248
Gene: ENSMUSG00000025903
AA Change: I202T

DomainStartEndE-ValueType
Pfam:Abhydrolase_2 8 215 1.3e-84 PFAM
Pfam:Abhydrolase_5 23 209 4.4e-14 PFAM
Pfam:Abhydrolase_6 24 160 3.6e-10 PFAM
Pfam:Abhydrolase_3 85 195 1.1e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155020
SMART Domains Protein: ENSMUSP00000136108
Gene: ENSMUSG00000104217

DomainStartEndE-ValueType
low complexity region 8 24 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the alpha/beta hydrolase superfamily. The encoded protein functions as a homodimer, exhibiting both depalmitoylating as well as lysophospholipase activity, and may be involved in Ras localization and signaling. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene have been defined on chromosomes 4, 6, and 7. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T C 13: 58,384,385 Y119C probably damaging Het
Abca12 A T 1: 71,349,155 C185* probably null Het
Abcc3 C T 11: 94,357,047 A1207T probably benign Het
Adam1b T G 5: 121,500,993 D663A probably damaging Het
Arhgap12 A T 18: 6,111,920 L148Q probably damaging Het
Cdh4 A T 2: 179,797,465 Q135L probably benign Het
Clca3b T C 3: 144,837,758 I437V probably benign Het
Cldn15 A T 5: 136,972,473 H124L probably benign Het
Cyp4a30b T C 4: 115,456,651 M143T probably damaging Het
Dgcr2 A T 16: 17,845,080 C353* probably null Het
Dhcr24 T A 4: 106,571,519 probably null Het
Dock1 T G 7: 134,745,008 L223R probably benign Het
Ece1 T A 4: 137,913,763 probably null Het
Efcab5 A G 11: 77,137,344 V387A probably benign Het
Efcab5 A G 11: 77,138,215 F97L possibly damaging Het
Eme2 A T 17: 24,894,569 probably null Het
Enpp1 G A 10: 24,660,161 T447I probably benign Het
Fam222b T C 11: 78,143,181 S17P probably benign Het
Fbln1 A G 15: 85,237,628 I317V probably benign Het
Fn1 T C 1: 71,637,339 K578E probably damaging Het
Fscb A T 12: 64,471,549 S1048T unknown Het
Fsd1l T A 4: 53,682,200 probably null Het
Gm340 A G 19: 41,584,315 K503R possibly damaging Het
Hexa T A 9: 59,563,939 I492K probably benign Het
Inpp5e G A 2: 26,397,858 A642V probably benign Het
Ints11 C T 4: 155,886,111 A241V probably damaging Het
Irs2 A G 8: 11,006,797 L545P probably damaging Het
Katnal2 G A 18: 76,993,575 A409V probably benign Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Lbx2 A G 6: 83,087,896 K138R probably damaging Het
Lpp G A 16: 24,977,279 A558T probably damaging Het
Magi3 G A 3: 104,034,114 P842S probably benign Het
Meioc G A 11: 102,666,342 V25M probably benign Het
Mthfr C T 4: 148,053,599 T557I probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Olfr1165-ps A T 2: 88,101,705 I94N probably damaging Het
Olfr314 T A 11: 58,786,484 Y83* probably null Het
Osbpl10 A T 9: 115,223,703 I440F probably damaging Het
Otx2 G A 14: 48,661,465 A36V probably benign Het
Parg A G 14: 32,210,508 Y435C probably damaging Het
Parvb A T 15: 84,282,784 D100V possibly damaging Het
Prss27 A G 17: 24,045,691 H276R probably benign Het
Prune1 T A 3: 95,255,046 S439C probably damaging Het
Pudp C G 18: 50,568,216 E149Q possibly damaging Het
Sin3a C A 9: 57,127,299 T1252N possibly damaging Het
Sptbn2 A G 19: 4,737,443 D927G probably benign Het
Stx18 C T 5: 38,104,907 T89I possibly damaging Het
Ticrr T C 7: 79,660,862 S175P possibly damaging Het
Tinag T C 9: 77,045,661 T14A probably benign Het
Tmco3 G A 8: 13,319,605 probably null Het
Trpm1 G T 7: 64,209,981 E396* probably null Het
Txndc11 A G 16: 11,084,299 Y684H probably damaging Het
Usp47 G A 7: 112,093,108 E926K probably benign Het
Vmn1r233 A G 17: 20,993,959 I243T probably damaging Het
Ythdf3 T A 3: 16,203,885 probably null Het
Zfp12 A G 5: 143,244,689 K289R probably damaging Het
Zfp950 T A 19: 61,119,112 H511L probably benign Het
Other mutations in Lypla1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00501:Lypla1 APN 1 4828587 missense probably damaging 1.00
IGL01571:Lypla1 APN 1 4844988 missense probably benign 0.15
IGL01592:Lypla1 APN 1 4828651 critical splice donor site probably null
IGL01865:Lypla1 APN 1 4837036 missense probably damaging 0.96
IGL02442:Lypla1 APN 1 4832387 splice site probably benign
IGL03005:Lypla1 APN 1 4832390 splice site probably benign
R0095:Lypla1 UTSW 1 4830327 splice site probably benign
R2278:Lypla1 UTSW 1 4841098 splice site probably null
R3766:Lypla1 UTSW 1 4840978 missense probably benign 0.04
R5805:Lypla1 UTSW 1 4830294 missense possibly damaging 0.54
R6014:Lypla1 UTSW 1 4808371 splice site probably null
R6027:Lypla1 UTSW 1 4837076 critical splice donor site probably null
R6842:Lypla1 UTSW 1 4832340 missense probably benign 0.14
R7564:Lypla1 UTSW 1 4808367 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCACAGTGCTTTATGTATCTGATAC -3'
(R):5'- ATGCTCATTTGTAAAAGGCGATCAG -3'

Sequencing Primer
(F):5'- ACATAACATTGCCTTTGTGTTTGTC -3'
(R):5'- CTTGGAAATATAACATGG -3'
Posted On2019-06-26