Incidental Mutation 'R7285:Fn1'
ID565918
Institutional Source Beutler Lab
Gene Symbol Fn1
Ensembl Gene ENSMUSG00000026193
Gene Namefibronectin 1
SynonymsFn-1, Fn
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7285 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location71585520-71653200 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 71637339 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 578 (K578E)
Ref Sequence ENSEMBL: ENSMUSP00000054499 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055226] [ENSMUST00000186129] [ENSMUST00000187938] [ENSMUST00000188674] [ENSMUST00000188894] [ENSMUST00000189821] [ENSMUST00000190780]
PDB Structure
SOLUTION NMR STRUCTURE OF LINKED CELL ATTACHMENT MODULES OF MOUSE FIBRONECTIN CONTAINING THE RGD AND SYNERGY REGIONS, 20 STRUCTURES [SOLUTION NMR]
SOLUTION NMR STRUCTURE OF LINKED CELL ATTACHMENT MODULES OF MOUSE FIBRONECTIN CONTAINING THE RGD AND SYNERGY REGIONS, 10 STRUCTURES [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000055226
AA Change: K578E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000054499
Gene: ENSMUSG00000026193
AA Change: K578E

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
FN1 53 93 6.38e-18 SMART
FN1 98 141 6.04e-19 SMART
FN1 142 185 6.94e-19 SMART
FN1 187 231 3.47e-19 SMART
FN1 232 276 6.04e-19 SMART
FN1 308 347 5.91e-13 SMART
FN2 353 401 6.66e-30 SMART
FN2 413 461 5.05e-30 SMART
FN1 470 513 2.59e-18 SMART
FN1 518 560 1.68e-17 SMART
FN1 561 604 5.69e-15 SMART
FN3 609 688 3.79e-2 SMART
FN3 719 798 1.27e-3 SMART
FN3 810 888 7.92e-14 SMART
FN3 906 985 4.28e-10 SMART
FN3 996 1074 2.53e-12 SMART
FN3 1086 1160 1.31e-5 SMART
FN3 1173 1255 1.13e-9 SMART
FN3 1264 1346 4.22e-9 SMART
FN3 1357 1437 9.6e-13 SMART
FN3 1448 1527 1.82e-13 SMART
FN3 1538 1617 6.69e-12 SMART
FN3 1632 1711 2.72e-12 SMART
FN3 1722 1801 8.9e-8 SMART
FN3 1812 1891 1.66e-7 SMART
FN3 1904 1983 4.92e-10 SMART
FN3 1993 2074 3.64e-13 SMART
low complexity region 2148 2165 N/A INTRINSIC
FN3 2193 2272 2.9e0 SMART
FN1 2296 2340 3.72e-19 SMART
FN1 2341 2383 2.49e-20 SMART
FN1 2385 2425 2.69e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000186129
AA Change: K578E

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000141123
Gene: ENSMUSG00000026193
AA Change: K578E

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
FN1 53 93 6.38e-18 SMART
FN1 98 141 6.04e-19 SMART
FN1 142 185 6.94e-19 SMART
FN1 187 231 3.47e-19 SMART
FN1 232 276 6.04e-19 SMART
FN1 308 347 5.91e-13 SMART
FN2 353 401 6.66e-30 SMART
FN2 413 461 5.05e-30 SMART
FN1 470 513 2.59e-18 SMART
FN1 518 560 1.68e-17 SMART
FN1 561 604 5.69e-15 SMART
FN3 609 688 3.79e-2 SMART
FN3 719 798 1.27e-3 SMART
FN3 810 888 7.92e-14 SMART
FN3 906 985 4.28e-10 SMART
FN3 996 1074 2.53e-12 SMART
FN3 1086 1160 1.31e-5 SMART
FN3 1173 1255 1.13e-9 SMART
FN3 1266 1346 9.6e-13 SMART
FN3 1357 1436 1.82e-13 SMART
FN3 1447 1526 6.69e-12 SMART
FN3 1541 1620 2.72e-12 SMART
FN3 1631 1710 1.66e-7 SMART
FN3 1723 1802 4.92e-10 SMART
FN3 1812 1893 3.64e-13 SMART
low complexity region 1967 1984 N/A INTRINSIC
FN3 2012 2091 2.9e0 SMART
FN1 2115 2159 3.72e-19 SMART
FN1 2160 2202 2.49e-20 SMART
FN1 2204 2244 2.69e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186613
Predicted Effect probably damaging
Transcript: ENSMUST00000187938
AA Change: K578E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140975
Gene: ENSMUSG00000026193
AA Change: K578E

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
FN1 53 93 6.38e-18 SMART
FN1 98 141 6.04e-19 SMART
FN1 142 185 6.94e-19 SMART
FN1 187 231 3.47e-19 SMART
FN1 232 276 6.04e-19 SMART
FN1 308 347 5.91e-13 SMART
FN2 353 401 6.66e-30 SMART
FN2 413 461 5.05e-30 SMART
FN1 470 513 2.59e-18 SMART
FN1 518 560 1.68e-17 SMART
FN1 561 604 5.69e-15 SMART
FN3 609 688 3.79e-2 SMART
FN3 719 798 1.27e-3 SMART
FN3 810 888 7.92e-14 SMART
FN3 906 985 4.28e-10 SMART
FN3 996 1074 2.53e-12 SMART
FN3 1086 1160 1.31e-5 SMART
FN3 1173 1255 1.13e-9 SMART
FN3 1266 1346 9.6e-13 SMART
FN3 1357 1436 1.82e-13 SMART
FN3 1447 1526 6.69e-12 SMART
FN3 1541 1620 2.72e-12 SMART
FN3 1631 1710 8.9e-8 SMART
FN3 1721 1800 1.66e-7 SMART
FN3 1813 1892 4.92e-10 SMART
FN3 1902 1983 3.64e-13 SMART
low complexity region 2032 2049 N/A INTRINSIC
FN3 2077 2156 2.9e0 SMART
FN1 2180 2224 3.72e-19 SMART
FN1 2225 2267 2.49e-20 SMART
FN1 2269 2309 2.69e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000188674
AA Change: K578E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140907
Gene: ENSMUSG00000026193
AA Change: K578E

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
FN1 53 93 6.38e-18 SMART
FN1 98 141 6.04e-19 SMART
FN1 142 185 6.94e-19 SMART
FN1 187 231 3.47e-19 SMART
FN1 232 276 6.04e-19 SMART
FN1 308 347 5.91e-13 SMART
FN2 353 401 6.66e-30 SMART
FN2 413 461 5.05e-30 SMART
FN1 470 513 2.59e-18 SMART
FN1 518 560 1.68e-17 SMART
FN1 561 604 5.69e-15 SMART
FN3 609 688 3.79e-2 SMART
FN3 719 798 1.27e-3 SMART
FN3 810 888 7.92e-14 SMART
FN3 906 985 4.28e-10 SMART
FN3 996 1074 2.53e-12 SMART
FN3 1086 1160 1.31e-5 SMART
FN3 1173 1255 1.13e-9 SMART
FN3 1266 1346 9.6e-13 SMART
FN3 1357 1436 1.82e-13 SMART
FN3 1447 1526 6.69e-12 SMART
FN3 1541 1620 2.72e-12 SMART
FN3 1631 1710 8.9e-8 SMART
FN3 1721 1800 1.66e-7 SMART
FN3 1813 1892 4.92e-10 SMART
FN3 1902 1981 6.79e-13 SMART
FN3 1983 2061 1.01e1 SMART
FN1 2085 2129 3.72e-19 SMART
FN1 2130 2172 2.49e-20 SMART
FN1 2174 2214 2.69e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000188894
AA Change: K578E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140471
Gene: ENSMUSG00000026193
AA Change: K578E

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
FN1 53 93 6.38e-18 SMART
FN1 98 141 6.04e-19 SMART
FN1 142 185 6.94e-19 SMART
FN1 187 231 3.47e-19 SMART
FN1 232 276 6.04e-19 SMART
FN1 308 347 5.91e-13 SMART
FN2 353 401 6.66e-30 SMART
FN2 413 461 5.05e-30 SMART
FN1 470 513 2.59e-18 SMART
FN1 518 560 1.68e-17 SMART
FN1 561 604 5.69e-15 SMART
FN3 609 688 3.79e-2 SMART
FN3 719 798 1.27e-3 SMART
FN3 810 888 7.92e-14 SMART
FN3 906 985 4.28e-10 SMART
FN3 996 1074 2.53e-12 SMART
FN3 1086 1160 1.31e-5 SMART
FN3 1173 1255 1.13e-9 SMART
FN3 1266 1346 9.6e-13 SMART
FN3 1357 1436 1.82e-13 SMART
FN3 1447 1526 6.69e-12 SMART
FN3 1541 1620 2.72e-12 SMART
FN3 1631 1710 8.9e-8 SMART
FN3 1721 1800 1.66e-7 SMART
FN3 1813 1892 4.92e-10 SMART
FN3 1902 1983 3.64e-13 SMART
low complexity region 2057 2074 N/A INTRINSIC
FN3 2102 2181 2.9e0 SMART
FN1 2205 2249 3.72e-19 SMART
FN1 2250 2292 2.49e-20 SMART
FN1 2294 2334 2.69e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000189821
AA Change: K578E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139702
Gene: ENSMUSG00000026193
AA Change: K578E

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
FN1 53 93 6.38e-18 SMART
FN1 98 141 6.04e-19 SMART
FN1 142 185 6.94e-19 SMART
FN1 187 231 3.47e-19 SMART
FN1 232 276 6.04e-19 SMART
FN1 308 347 5.91e-13 SMART
FN2 353 401 6.66e-30 SMART
FN2 413 461 5.05e-30 SMART
FN1 470 513 2.59e-18 SMART
FN1 518 560 1.68e-17 SMART
FN1 561 604 5.69e-15 SMART
FN3 609 688 3.79e-2 SMART
FN3 719 798 1.27e-3 SMART
FN3 810 888 7.92e-14 SMART
FN3 906 985 4.28e-10 SMART
FN3 996 1074 2.53e-12 SMART
FN3 1086 1160 1.31e-5 SMART
FN3 1173 1255 1.13e-9 SMART
FN3 1266 1346 9.6e-13 SMART
FN3 1357 1436 1.82e-13 SMART
FN3 1447 1526 6.69e-12 SMART
FN3 1541 1620 2.72e-12 SMART
FN3 1631 1710 1.66e-7 SMART
FN3 1723 1802 4.92e-10 SMART
FN3 1812 1891 6.79e-13 SMART
FN3 1893 1971 1.01e1 SMART
FN1 1995 2039 3.72e-19 SMART
FN1 2040 2082 2.49e-20 SMART
FN1 2084 2124 2.69e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000190780
AA Change: K578E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140816
Gene: ENSMUSG00000026193
AA Change: K578E

DomainStartEndE-ValueType
low complexity region 2 19 N/A INTRINSIC
FN1 53 93 6.38e-18 SMART
FN1 98 141 6.04e-19 SMART
FN1 142 185 6.94e-19 SMART
FN1 187 231 3.47e-19 SMART
FN1 232 276 6.04e-19 SMART
FN1 308 347 5.91e-13 SMART
FN2 353 401 6.66e-30 SMART
FN2 413 461 5.05e-30 SMART
FN1 470 513 2.59e-18 SMART
FN1 518 560 1.68e-17 SMART
FN1 561 604 5.69e-15 SMART
FN3 609 688 3.79e-2 SMART
FN3 719 798 1.27e-3 SMART
FN3 810 888 7.92e-14 SMART
FN3 906 985 4.28e-10 SMART
FN3 996 1074 2.53e-12 SMART
FN3 1086 1160 1.31e-5 SMART
FN3 1173 1255 1.13e-9 SMART
FN3 1266 1346 9.6e-13 SMART
FN3 1357 1436 1.82e-13 SMART
FN3 1447 1526 6.69e-12 SMART
FN3 1541 1620 2.72e-12 SMART
FN3 1631 1710 1.66e-7 SMART
FN3 1723 1802 4.92e-10 SMART
FN3 1812 1893 3.64e-13 SMART
low complexity region 1942 1959 N/A INTRINSIC
FN3 1987 2066 2.9e0 SMART
FN1 2090 2134 3.72e-19 SMART
FN1 2135 2177 2.49e-20 SMART
FN1 2179 2219 2.69e-16 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes fibronectin, a glycoprotein present in a soluble dimeric form in plasma, and in a dimeric or multimeric form at the cell surface and in extracellular matrix. The encoded preproprotein is proteolytically processed to generate the mature protein. Fibronectin is involved in cell adhesion and migration processes including embryogenesis, wound healing, blood coagulation, host defense, and metastasis. The gene has three regions subject to alternative splicing, with the potential to produce 20 different transcript variants, at least one of which encodes an isoform that undergoes proteolytic processing. The full-length nature of some variants has not been determined. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mutants are defective in mesodermal function. Null mutants are embryonic lethal with major patterning and organizational defects. Conditional mutants live and show increased neuronal apoptosis and susceptibility to induced cerebral ischemia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T C 13: 58,384,385 Y119C probably damaging Het
Abca12 A T 1: 71,349,155 C185* probably null Het
Abcc3 C T 11: 94,357,047 A1207T probably benign Het
Adam1b T G 5: 121,500,993 D663A probably damaging Het
Arhgap12 A T 18: 6,111,920 L148Q probably damaging Het
Cdh4 A T 2: 179,797,465 Q135L probably benign Het
Clca3b T C 3: 144,837,758 I437V probably benign Het
Cldn15 A T 5: 136,972,473 H124L probably benign Het
Cyp4a30b T C 4: 115,456,651 M143T probably damaging Het
Dgcr2 A T 16: 17,845,080 C353* probably null Het
Dhcr24 T A 4: 106,571,519 probably null Het
Dock1 T G 7: 134,745,008 L223R probably benign Het
Ece1 T A 4: 137,913,763 probably null Het
Efcab5 A G 11: 77,137,344 V387A probably benign Het
Efcab5 A G 11: 77,138,215 F97L possibly damaging Het
Eme2 A T 17: 24,894,569 probably null Het
Enpp1 G A 10: 24,660,161 T447I probably benign Het
Fam222b T C 11: 78,143,181 S17P probably benign Het
Fbln1 A G 15: 85,237,628 I317V probably benign Het
Fscb A T 12: 64,471,549 S1048T unknown Het
Fsd1l T A 4: 53,682,200 probably null Het
Gm340 A G 19: 41,584,315 K503R possibly damaging Het
Hexa T A 9: 59,563,939 I492K probably benign Het
Inpp5e G A 2: 26,397,858 A642V probably benign Het
Ints11 C T 4: 155,886,111 A241V probably damaging Het
Irs2 A G 8: 11,006,797 L545P probably damaging Het
Katnal2 G A 18: 76,993,575 A409V probably benign Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Lbx2 A G 6: 83,087,896 K138R probably damaging Het
Lpp G A 16: 24,977,279 A558T probably damaging Het
Lypla1 T C 1: 4,841,098 I202T probably benign Het
Magi3 G A 3: 104,034,114 P842S probably benign Het
Meioc G A 11: 102,666,342 V25M probably benign Het
Mthfr C T 4: 148,053,599 T557I probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Olfr1165-ps A T 2: 88,101,705 I94N probably damaging Het
Olfr314 T A 11: 58,786,484 Y83* probably null Het
Osbpl10 A T 9: 115,223,703 I440F probably damaging Het
Otx2 G A 14: 48,661,465 A36V probably benign Het
Parg A G 14: 32,210,508 Y435C probably damaging Het
Parvb A T 15: 84,282,784 D100V possibly damaging Het
Prss27 A G 17: 24,045,691 H276R probably benign Het
Prune1 T A 3: 95,255,046 S439C probably damaging Het
Pudp C G 18: 50,568,216 E149Q possibly damaging Het
Sin3a C A 9: 57,127,299 T1252N possibly damaging Het
Sptbn2 A G 19: 4,737,443 D927G probably benign Het
Stx18 C T 5: 38,104,907 T89I possibly damaging Het
Ticrr T C 7: 79,660,862 S175P possibly damaging Het
Tinag T C 9: 77,045,661 T14A probably benign Het
Tmco3 G A 8: 13,319,605 probably null Het
Trpm1 G T 7: 64,209,981 E396* probably null Het
Txndc11 A G 16: 11,084,299 Y684H probably damaging Het
Usp47 G A 7: 112,093,108 E926K probably benign Het
Vmn1r233 A G 17: 20,993,959 I243T probably damaging Het
Ythdf3 T A 3: 16,203,885 probably null Het
Zfp12 A G 5: 143,244,689 K289R probably damaging Het
Zfp950 T A 19: 61,119,112 H511L probably benign Het
Other mutations in Fn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00236:Fn1 APN 1 71652873 missense probably benign 0.28
IGL00402:Fn1 APN 1 71641163 missense probably damaging 1.00
IGL00946:Fn1 APN 1 71645540 splice site probably benign
IGL01311:Fn1 APN 1 71628140 missense probably damaging 1.00
IGL01338:Fn1 APN 1 71626210 missense probably damaging 0.98
IGL01353:Fn1 APN 1 71586939 missense probably damaging 1.00
IGL01674:Fn1 APN 1 71606741 missense probably damaging 1.00
IGL01701:Fn1 APN 1 71629853 splice site probably benign
IGL01734:Fn1 APN 1 71619485 missense probably damaging 1.00
IGL01788:Fn1 APN 1 71613837 missense probably damaging 1.00
IGL02186:Fn1 APN 1 71638534 missense probably damaging 1.00
IGL02398:Fn1 APN 1 71618670 splice site probably null
IGL02425:Fn1 APN 1 71641143 splice site probably benign
IGL02516:Fn1 APN 1 71637323 missense possibly damaging 0.78
IGL02593:Fn1 APN 1 71602432 missense probably benign
IGL02651:Fn1 APN 1 71597676 missense possibly damaging 0.65
IGL02681:Fn1 APN 1 71619482 missense probably damaging 1.00
IGL02890:Fn1 APN 1 71598372 critical splice donor site probably null
IGL02929:Fn1 APN 1 71595662 critical splice donor site probably null
IGL03036:Fn1 APN 1 71629773 missense probably damaging 1.00
IGL03088:Fn1 APN 1 71614038 splice site probably null
IGL03142:Fn1 APN 1 71637296 missense probably damaging 1.00
IGL03172:Fn1 APN 1 71641262 missense probably damaging 0.99
IGL03184:Fn1 APN 1 71609497 missense probably benign 0.02
IGL03212:Fn1 APN 1 71641325 nonsense probably null
IGL03246:Fn1 APN 1 71624296 missense possibly damaging 0.89
IGL03367:Fn1 APN 1 71597553 missense probably benign 0.27
PIT4514001:Fn1 UTSW 1 71628456 missense probably benign 0.01
R0008:Fn1 UTSW 1 71595720 missense probably damaging 0.98
R0112:Fn1 UTSW 1 71609653 missense probably damaging 1.00
R0138:Fn1 UTSW 1 71624110 missense possibly damaging 0.82
R0383:Fn1 UTSW 1 71597685 missense probably damaging 0.99
R0386:Fn1 UTSW 1 71595786 missense probably damaging 1.00
R0648:Fn1 UTSW 1 71597585 missense possibly damaging 0.79
R0684:Fn1 UTSW 1 71595809 splice site probably null
R1054:Fn1 UTSW 1 71586214 makesense probably null
R1183:Fn1 UTSW 1 71586245 missense probably damaging 0.98
R1405:Fn1 UTSW 1 71642078 missense probably damaging 1.00
R1405:Fn1 UTSW 1 71642078 missense probably damaging 1.00
R1414:Fn1 UTSW 1 71601303 splice site probably benign
R1677:Fn1 UTSW 1 71597655 missense probably benign 0.00
R1773:Fn1 UTSW 1 71637383 missense probably damaging 1.00
R1830:Fn1 UTSW 1 71624259 missense probably damaging 1.00
R1987:Fn1 UTSW 1 71651625 missense probably damaging 1.00
R1989:Fn1 UTSW 1 71651625 missense probably damaging 1.00
R2068:Fn1 UTSW 1 71600439 missense probably damaging 1.00
R2113:Fn1 UTSW 1 71626164 missense probably damaging 1.00
R2145:Fn1 UTSW 1 71606004 missense probably damaging 1.00
R2246:Fn1 UTSW 1 71628535 missense probably benign 0.10
R2273:Fn1 UTSW 1 71613943 missense probably null 1.00
R2274:Fn1 UTSW 1 71613943 missense probably null 1.00
R2275:Fn1 UTSW 1 71613943 missense probably null 1.00
R2303:Fn1 UTSW 1 71614036 critical splice acceptor site probably null
R2379:Fn1 UTSW 1 71649284 nonsense probably null
R2382:Fn1 UTSW 1 71648119 missense probably damaging 1.00
R2567:Fn1 UTSW 1 71597736 nonsense probably null
R2864:Fn1 UTSW 1 71602419 missense probably damaging 0.99
R3154:Fn1 UTSW 1 71593083 missense probably damaging 1.00
R3837:Fn1 UTSW 1 71653155 utr 5 prime probably null
R3844:Fn1 UTSW 1 71609574 missense possibly damaging 0.61
R3886:Fn1 UTSW 1 71640306 missense probably damaging 1.00
R3887:Fn1 UTSW 1 71640306 missense probably damaging 1.00
R3888:Fn1 UTSW 1 71640306 missense probably damaging 1.00
R3889:Fn1 UTSW 1 71640306 missense probably damaging 1.00
R3905:Fn1 UTSW 1 71607913 missense probably damaging 1.00
R3906:Fn1 UTSW 1 71607913 missense probably damaging 1.00
R3907:Fn1 UTSW 1 71607913 missense probably damaging 1.00
R3909:Fn1 UTSW 1 71607913 missense probably damaging 1.00
R4611:Fn1 UTSW 1 71624178 nonsense probably null
R4724:Fn1 UTSW 1 71648148 critical splice acceptor site probably null
R4732:Fn1 UTSW 1 71602512 splice site probably null
R4733:Fn1 UTSW 1 71602512 splice site probably null
R4756:Fn1 UTSW 1 71590808 missense probably damaging 1.00
R4809:Fn1 UTSW 1 71652800 intron probably benign
R4839:Fn1 UTSW 1 71642083 missense probably damaging 1.00
R4915:Fn1 UTSW 1 71595809 splice site probably null
R4917:Fn1 UTSW 1 71595809 splice site probably null
R4918:Fn1 UTSW 1 71595809 splice site probably null
R5002:Fn1 UTSW 1 71629728 missense possibly damaging 0.48
R5015:Fn1 UTSW 1 71626177 missense probably damaging 0.98
R5022:Fn1 UTSW 1 71624179 missense probably damaging 1.00
R5109:Fn1 UTSW 1 71649235 missense probably damaging 1.00
R5267:Fn1 UTSW 1 71629704 missense probably damaging 1.00
R5323:Fn1 UTSW 1 71597432 missense probably benign 0.09
R5333:Fn1 UTSW 1 71624180 missense probably damaging 1.00
R5631:Fn1 UTSW 1 71590196 missense probably damaging 1.00
R5644:Fn1 UTSW 1 71627250 missense probably damaging 1.00
R5754:Fn1 UTSW 1 71600322 missense probably damaging 1.00
R5807:Fn1 UTSW 1 71648059 missense probably damaging 1.00
R6053:Fn1 UTSW 1 71599290 missense probably damaging 1.00
R6133:Fn1 UTSW 1 71597727 missense probably damaging 1.00
R6186:Fn1 UTSW 1 71637290 missense probably damaging 1.00
R6270:Fn1 UTSW 1 71637275 missense probably damaging 1.00
R6332:Fn1 UTSW 1 71628071 missense probably benign 0.01
R6431:Fn1 UTSW 1 71647844 intron probably null
R6571:Fn1 UTSW 1 71626190 missense probably damaging 1.00
R6596:Fn1 UTSW 1 71609482 missense probably damaging 1.00
R6862:Fn1 UTSW 1 71613907 missense probably benign 0.43
R6898:Fn1 UTSW 1 71600413 missense probably damaging 1.00
R6984:Fn1 UTSW 1 71626079 missense probably damaging 1.00
R7107:Fn1 UTSW 1 71627249 missense probably damaging 1.00
R7121:Fn1 UTSW 1 71600538 intron probably benign
R7127:Fn1 UTSW 1 71597544 missense probably benign 0.16
R7194:Fn1 UTSW 1 71602323 missense probably damaging 1.00
R7274:Fn1 UTSW 1 71628113 missense probably benign
R7426:Fn1 UTSW 1 71649225 missense probably damaging 1.00
R7453:Fn1 UTSW 1 71590880 missense probably damaging 1.00
R7508:Fn1 UTSW 1 71597516 missense probably benign 0.01
R7724:Fn1 UTSW 1 71603735 missense probably benign 0.02
X0023:Fn1 UTSW 1 71598373 critical splice donor site probably null
Z1088:Fn1 UTSW 1 71649292 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGAGTCCTCAACTGTGTAAAATG -3'
(R):5'- TACTTTAGGACTGGGGAAATGG -3'

Sequencing Primer
(F):5'- AGCATGCACTTTTTCATAGTCTTTGG -3'
(R):5'- TGGTTTCACACAACATATGCACG -3'
Posted On2019-06-26