Mutagenetix > Incidental Mutations

Incidental Mutation 'R0635:Il2ra'

56592

Institutional Source

Beutler Lab

Gene Symbol

Il2ra

Ensembl Gene

ENSMUSG00000026770

Gene Name

interleukin 2 receptor, alpha chain

Synonyms

CD25, Ly-43, Il2r, IL-2R alpha chain

MMRRC Submission

038824-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R0635 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

11642807-11693193 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 11680366 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Methionine at position 171 (T171M)

Ref Sequence

ENSEMBL: ENSMUSP00000028111 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028111]

Predicted Effect

probably benign
Transcript: ENSMUST00000028111
AA Change: T171M

PolyPhen 2 Score 0.382 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000028111
Gene: ENSMUSG00000026770
AA Change: T171M

Domain	Start	End	E-Value	Type
signal peptide	1	21	N/A	INTRINSIC
CCP	24	77	5e-2	SMART
CCP	121	180	1.2e-4	SMART
low complexity region	212	223	N/A	INTRINSIC
transmembrane domain	235	257	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000193001

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000195427

Meta Mutation Damage Score

0.0898

Coding Region Coverage

1x: 99.4%
3x: 98.8%
10x: 97.4%
20x: 94.9%

Validation Efficiency

99% (68/69)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The interleukin 2 (IL2) receptor alpha (IL2RA) and beta (IL2RB) chains, together with the common gamma chain (IL2RG), constitute the high-affinity IL2 receptor. Homodimeric alpha chains (IL2RA) result in low-affinity receptor, while homodimeric beta (IL2RB) chains produce a medium-affinity receptor. Normally an integral-membrane protein, soluble IL2RA has been isolated and determined to result from extracellular proteolyisis. Alternately-spliced IL2RA mRNAs have been isolated, but the significance of each is presently unknown. Mutations in this gene are associated with interleukin 2 receptor alpha deficiency.[provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit massive proliferation of polyclonal T and B cells as adults and develop autoimmune disorders including inflammatory bowel disease and hemolytic anemia with age. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 64 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
3632451O06Rik	A	G	14: 49,773,143	L369S	probably benign	Het
4932429P05Rik	T	C	X: 89,752,522		probably benign	Het
5730455P16Rik	A	T	11: 80,374,065		probably benign	Het
Adamts15	A	G	9: 30,904,770	L631P	probably damaging	Het
Adamts17	T	C	7: 66,908,605	F266L	probably damaging	Het
Adgrb1	C	A	15: 74,540,892	Q488K	possibly damaging	Het
Cep290	A	G	10: 100,492,676	D109G	probably damaging	Het
Chil5	A	T	3: 106,017,203	Y229N	possibly damaging	Het
Cntnap1	A	G	11: 101,183,459	T742A	probably benign	Het
Col6a3	A	T	1: 90,808,086		probably null	Het
Col6a5	G	A	9: 105,928,606	P1034S	unknown	Het
Daxx	T	A	17: 33,912,644	D442E	probably benign	Het
Dmxl1	T	C	18: 49,851,423		probably benign	Het
Dnah11	A	G	12: 118,007,996	F2942S	probably damaging	Het
Fam71a	T	C	1: 191,163,727	T240A	probably benign	Het
Glg1	A	G	8: 111,163,764		probably benign	Het
Gm10272	G	A	10: 77,706,701		probably benign	Het
Gm17333	AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA	AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA	16: 77,852,878		noncoding transcript	Het
Haao	A	G	17: 83,838,574	F83S	probably damaging	Het
Hdgfl2	T	A	17: 56,096,057	L177Q	probably damaging	Het
Hrh1	T	C	6: 114,480,145	V129A	probably damaging	Het
Ift43	T	A	12: 86,085,081		probably benign	Het
Il21r	T	C	7: 125,632,506	Y369H	probably damaging	Het
Lao1	C	T	4: 118,968,296	R438C	probably benign	Het
Lrrcc1	G	A	3: 14,559,228	S350N	probably benign	Het
Mageb5	T	A	X: 91,779,993	Y260F	probably benign	Het
March5	A	T	19: 37,220,408	I159F	possibly damaging	Het
Mgat4a	G	A	1: 37,452,294	A282V	probably benign	Het
Mipep	G	A	14: 60,829,390	V420I	probably damaging	Het
Morc2b	A	T	17: 33,137,687	F370L	possibly damaging	Het
Mt1	A	T	8: 94,179,821		probably null	Het
Ncapd2	A	G	6: 125,173,036	V943A	probably benign	Het
Nkd2	T	C	13: 73,826,894	D58G	probably benign	Het
Nol8	C	G	13: 49,676,758	S1106C	probably benign	Het
Nrm	C	A	17: 35,864,264	Y61*	probably null	Het
Nusap1	A	G	2: 119,627,667	T95A	probably damaging	Het
Ocln	T	A	13: 100,506,236	Q197L	probably damaging	Het
Olfr495	T	A	7: 108,395,764	F215I	probably benign	Het
Oxtr	A	G	6: 112,489,200	Y200H	probably damaging	Het
Paip2b	T	C	6: 83,809,909	E115G	possibly damaging	Het
Pcm1	T	A	8: 41,267,179		probably benign	Het
Pcnt	T	C	10: 76,404,585	D1205G	probably damaging	Het
Phka1	G	A	X: 102,621,400	R186C	probably damaging	Het
Pik3cb	A	G	9: 99,064,218		probably benign	Het
Pik3r1	C	T	13: 101,757,418	R81K	probably benign	Het
Ppa1	A	G	10: 61,665,440	D162G	probably benign	Het
Ppa1	A	G	10: 61,666,970	R191G	probably damaging	Het
Prss22	T	A	17: 23,996,688	T87S	probably benign	Het
Rgr	T	A	14: 37,038,947	R218*	probably null	Het
Rreb1	A	T	13: 37,941,564	Q1282L	possibly damaging	Het
Scel	T	A	14: 103,583,139		probably null	Het
Sema6b	A	G	17: 56,129,971		probably null	Het
Slc4a1	T	C	11: 102,352,672	E711G	possibly damaging	Het
Snx19	C	A	9: 30,428,810	L415M	probably damaging	Het
Snx19	T	G	9: 30,428,811	L415R	probably damaging	Het
Specc1	G	A	11: 62,118,903	R495Q	probably damaging	Het
Tead1	T	C	7: 112,891,706		probably benign	Het
Timm10b	A	C	7: 105,640,688		probably benign	Het
Ubxn7	T	A	16: 32,367,417		probably benign	Het
Vmn2r116	T	A	17: 23,386,887	Y258N	possibly damaging	Het
Vmn2r77	T	A	7: 86,811,175	F570I	probably benign	Het
Vmn2r98	T	C	17: 19,080,497	V587A	probably benign	Het
Zfp398	T	C	6: 47,863,140	I101T	probably damaging	Het
Zfp808	T	A	13: 62,172,419	H487Q	probably damaging	Het

Other mutations in Il2ra

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00824:Il2ra	APN	2	11683099	missense	probably benign	0.12
IGL01393:Il2ra	APN	2	11683054	missense	probably damaging	0.99
IGL01594:Il2ra	APN	2	11680396	missense	possibly damaging	0.85
IGL02519:Il2ra	APN	2	11683090	missense	possibly damaging	0.91
R0206:Il2ra	UTSW	2	11682017	splice site	probably benign
R0208:Il2ra	UTSW	2	11682017	splice site	probably benign
R0666:Il2ra	UTSW	2	11643073	splice site	probably benign
R4732:Il2ra	UTSW	2	11676920	missense	probably benign
R4733:Il2ra	UTSW	2	11676920	missense	probably benign
R4959:Il2ra	UTSW	2	11676853	missense	possibly damaging	0.91
R5006:Il2ra	UTSW	2	11674346	missense	possibly damaging	0.83
R5531:Il2ra	UTSW	2	11676892	missense	possibly damaging	0.91
R5899:Il2ra	UTSW	2	11684437	missense	probably benign
R6145:Il2ra	UTSW	2	11680246	missense	probably damaging	1.00
R6184:Il2ra	UTSW	2	11647979	intron	probably benign
R6449:Il2ra	UTSW	2	11680362	missense	probably benign
R6472:Il2ra	UTSW	2	11681969	missense	possibly damaging	0.91
R7300:Il2ra	UTSW	2	11676910	missense	not run
R7371:Il2ra	UTSW	2	11643020	missense	probably benign	0.07
R7855:Il2ra	UTSW	2	11680336	missense	possibly damaging	0.65
R7922:Il2ra	UTSW	2	11674366	missense	possibly damaging	0.93
R7963:Il2ra	UTSW	2	11674424	missense	probably benign	0.05
R8338:Il2ra	UTSW	2	11683074	missense	probably benign
Z1176:Il2ra	UTSW	2	11681931	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCATTTGCTGTGTCTTCCCAAAC -3'
(R):5'- ACCGGAGAGATCCTCATTTCCCTG -3'

Sequencing Primer
(F):5'- TCCCAAACTTGCCTTCAAAATTC -3'
(R):5'- GTTAAGGGAACCTCAGCATTTCG -3'

Posted On

2013-07-11