Incidental Mutation 'R0635:Il2ra'
ID 56592
Institutional Source Beutler Lab
Gene Symbol Il2ra
Ensembl Gene ENSMUSG00000026770
Gene Name interleukin 2 receptor, alpha chain
Synonyms CD25, Ly-43, Il2r, IL-2R alpha chain
MMRRC Submission 038824-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0635 (G1)
Quality Score 225
Status Validated
Chromosome 2
Chromosomal Location 11642807-11693193 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) C to T at 11680366 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Methionine at position 171 (T171M)
Ref Sequence ENSEMBL: ENSMUSP00000028111 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028111]
AlphaFold P01590
Predicted Effect probably benign
Transcript: ENSMUST00000028111
AA Change: T171M

PolyPhen 2 Score 0.382 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000028111
Gene: ENSMUSG00000026770
AA Change: T171M

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
CCP 24 77 5e-2 SMART
CCP 121 180 1.2e-4 SMART
low complexity region 212 223 N/A INTRINSIC
transmembrane domain 235 257 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193001
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195427
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 99% (68/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The interleukin 2 (IL2) receptor alpha (IL2RA) and beta (IL2RB) chains, together with the common gamma chain (IL2RG), constitute the high-affinity IL2 receptor. Homodimeric alpha chains (IL2RA) result in low-affinity receptor, while homodimeric beta (IL2RB) chains produce a medium-affinity receptor. Normally an integral-membrane protein, soluble IL2RA has been isolated and determined to result from extracellular proteolyisis. Alternately-spliced IL2RA mRNAs have been isolated, but the significance of each is presently unknown. Mutations in this gene are associated with interleukin 2 receptor alpha deficiency.[provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit massive proliferation of polyclonal T and B cells as adults and develop autoimmune disorders including inflammatory bowel disease and hemolytic anemia with age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik A G 14: 49,773,143 (GRCm38) L369S probably benign Het
4932429P05Rik T C X: 89,752,522 (GRCm38) probably benign Het
5730455P16Rik A T 11: 80,374,065 (GRCm38) probably benign Het
Adamts15 A G 9: 30,904,770 (GRCm38) L631P probably damaging Het
Adamts17 T C 7: 66,908,605 (GRCm38) F266L probably damaging Het
Adgrb1 C A 15: 74,540,892 (GRCm38) Q488K possibly damaging Het
Cep290 A G 10: 100,492,676 (GRCm38) D109G probably damaging Het
Chil5 A T 3: 106,017,203 (GRCm38) Y229N possibly damaging Het
Cntnap1 A G 11: 101,183,459 (GRCm38) T742A probably benign Het
Col6a3 A T 1: 90,808,086 (GRCm38) probably null Het
Col6a5 G A 9: 105,928,606 (GRCm38) P1034S unknown Het
Daxx T A 17: 33,912,644 (GRCm38) D442E probably benign Het
Dmxl1 T C 18: 49,851,423 (GRCm38) probably benign Het
Dnah11 A G 12: 118,007,996 (GRCm38) F2942S probably damaging Het
Fam71a T C 1: 191,163,727 (GRCm38) T240A probably benign Het
Glg1 A G 8: 111,163,764 (GRCm38) probably benign Het
Gm10272 G A 10: 77,706,701 (GRCm38) probably benign Het
Gm17333 AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA 16: 77,852,878 (GRCm38) noncoding transcript Het
Haao A G 17: 83,838,574 (GRCm38) F83S probably damaging Het
Hdgfl2 T A 17: 56,096,057 (GRCm38) L177Q probably damaging Het
Hrh1 T C 6: 114,480,145 (GRCm38) V129A probably damaging Het
Ift43 T A 12: 86,085,081 (GRCm38) probably benign Het
Il21r T C 7: 125,632,506 (GRCm38) Y369H probably damaging Het
Lao1 C T 4: 118,968,296 (GRCm38) R438C probably benign Het
Lrrcc1 G A 3: 14,559,228 (GRCm38) S350N probably benign Het
Mageb5 T A X: 91,779,993 (GRCm38) Y260F probably benign Het
March5 A T 19: 37,220,408 (GRCm38) I159F possibly damaging Het
Mgat4a G A 1: 37,452,294 (GRCm38) A282V probably benign Het
Mipep G A 14: 60,829,390 (GRCm38) V420I probably damaging Het
Morc2b A T 17: 33,137,687 (GRCm38) F370L possibly damaging Het
Mt1 A T 8: 94,179,821 (GRCm38) probably null Het
Ncapd2 A G 6: 125,173,036 (GRCm38) V943A probably benign Het
Nkd2 T C 13: 73,826,894 (GRCm38) D58G probably benign Het
Nol8 C G 13: 49,676,758 (GRCm38) S1106C probably benign Het
Nrm C A 17: 35,864,264 (GRCm38) Y61* probably null Het
Nusap1 A G 2: 119,627,667 (GRCm38) T95A probably damaging Het
Ocln T A 13: 100,506,236 (GRCm38) Q197L probably damaging Het
Olfr495 T A 7: 108,395,764 (GRCm38) F215I probably benign Het
Oxtr A G 6: 112,489,200 (GRCm38) Y200H probably damaging Het
Paip2b T C 6: 83,809,909 (GRCm38) E115G possibly damaging Het
Pcm1 T A 8: 41,267,179 (GRCm38) probably benign Het
Pcnt T C 10: 76,404,585 (GRCm38) D1205G probably damaging Het
Phka1 G A X: 102,621,400 (GRCm38) R186C probably damaging Het
Pik3cb A G 9: 99,064,218 (GRCm38) probably benign Het
Pik3r1 C T 13: 101,757,418 (GRCm38) R81K probably benign Het
Ppa1 A G 10: 61,666,970 (GRCm38) R191G probably damaging Het
Ppa1 A G 10: 61,665,440 (GRCm38) D162G probably benign Het
Prss22 T A 17: 23,996,688 (GRCm38) T87S probably benign Het
Rgr T A 14: 37,038,947 (GRCm38) R218* probably null Het
Rreb1 A T 13: 37,941,564 (GRCm38) Q1282L possibly damaging Het
Scel T A 14: 103,583,139 (GRCm38) probably null Het
Sema6b A G 17: 56,129,971 (GRCm38) probably null Het
Slc4a1 T C 11: 102,352,672 (GRCm38) E711G possibly damaging Het
Snx19 T G 9: 30,428,811 (GRCm38) L415R probably damaging Het
Snx19 C A 9: 30,428,810 (GRCm38) L415M probably damaging Het
Specc1 G A 11: 62,118,903 (GRCm38) R495Q probably damaging Het
Tead1 T C 7: 112,891,706 (GRCm38) probably benign Het
Timm10b A C 7: 105,640,688 (GRCm38) probably benign Het
Ubxn7 T A 16: 32,367,417 (GRCm38) probably benign Het
Vmn2r116 T A 17: 23,386,887 (GRCm38) Y258N possibly damaging Het
Vmn2r77 T A 7: 86,811,175 (GRCm38) F570I probably benign Het
Vmn2r98 T C 17: 19,080,497 (GRCm38) V587A probably benign Het
Zfp398 T C 6: 47,863,140 (GRCm38) I101T probably damaging Het
Zfp808 T A 13: 62,172,419 (GRCm38) H487Q probably damaging Het
Other mutations in Il2ra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00824:Il2ra APN 2 11,683,099 (GRCm38) missense probably benign 0.12
IGL01393:Il2ra APN 2 11,683,054 (GRCm38) missense probably damaging 0.99
IGL01594:Il2ra APN 2 11,680,396 (GRCm38) missense possibly damaging 0.85
IGL02519:Il2ra APN 2 11,683,090 (GRCm38) missense possibly damaging 0.91
R0206:Il2ra UTSW 2 11,682,017 (GRCm38) splice site probably benign
R0208:Il2ra UTSW 2 11,682,017 (GRCm38) splice site probably benign
R0666:Il2ra UTSW 2 11,643,073 (GRCm38) splice site probably benign
R4732:Il2ra UTSW 2 11,676,920 (GRCm38) missense probably benign
R4733:Il2ra UTSW 2 11,676,920 (GRCm38) missense probably benign
R4959:Il2ra UTSW 2 11,676,853 (GRCm38) missense possibly damaging 0.91
R5006:Il2ra UTSW 2 11,674,346 (GRCm38) missense possibly damaging 0.83
R5531:Il2ra UTSW 2 11,676,892 (GRCm38) missense possibly damaging 0.91
R5899:Il2ra UTSW 2 11,684,437 (GRCm38) missense probably benign
R6145:Il2ra UTSW 2 11,680,246 (GRCm38) missense probably damaging 1.00
R6184:Il2ra UTSW 2 11,647,979 (GRCm38) intron probably benign
R6449:Il2ra UTSW 2 11,680,362 (GRCm38) missense probably benign
R6472:Il2ra UTSW 2 11,681,969 (GRCm38) missense possibly damaging 0.91
R7300:Il2ra UTSW 2 11,676,910 (GRCm38) missense not run
R7371:Il2ra UTSW 2 11,643,020 (GRCm38) missense probably benign 0.07
R7855:Il2ra UTSW 2 11,680,336 (GRCm38) missense possibly damaging 0.65
R7922:Il2ra UTSW 2 11,674,366 (GRCm38) missense possibly damaging 0.93
R7963:Il2ra UTSW 2 11,674,424 (GRCm38) missense probably benign 0.05
R8338:Il2ra UTSW 2 11,683,074 (GRCm38) missense probably benign
R9193:Il2ra UTSW 2 11,684,391 (GRCm38) missense possibly damaging 0.85
R9418:Il2ra UTSW 2 11,684,392 (GRCm38) missense possibly damaging 0.93
R9634:Il2ra UTSW 2 11,680,416 (GRCm38) nonsense probably null
R9789:Il2ra UTSW 2 11,680,350 (GRCm38) missense probably benign 0.00
Z1176:Il2ra UTSW 2 11,681,931 (GRCm38) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCATTTGCTGTGTCTTCCCAAAC -3'
(R):5'- ACCGGAGAGATCCTCATTTCCCTG -3'

Sequencing Primer
(F):5'- TCCCAAACTTGCCTTCAAAATTC -3'
(R):5'- GTTAAGGGAACCTCAGCATTTCG -3'
Posted On 2013-07-11