Incidental Mutation 'R7285:Fsd1l'
ID565925
Institutional Source Beutler Lab
Gene Symbol Fsd1l
Ensembl Gene ENSMUSG00000054752
Gene Namefibronectin type III and SPRY domain containing 1-like
SynonymsA230072O16Rik, Csdufd1, Fsd1nl, Ccdc10
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.705) question?
Stock #R7285 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location53631471-53707009 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 53682200 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000124002 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000132151] [ENSMUST00000159415] [ENSMUST00000163067] [ENSMUST00000180164]
Predicted Effect probably null
Transcript: ENSMUST00000132151
SMART Domains Protein: ENSMUSP00000114931
Gene: ENSMUSG00000054752

DomainStartEndE-ValueType
BBC 4 130 4.3e-8 SMART
FN3 165 255 2.21e-3 SMART
Pfam:SPRY 350 470 3.2e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000159415
SMART Domains Protein: ENSMUSP00000124002
Gene: ENSMUSG00000054752

DomainStartEndE-ValueType
BBC 4 130 4.3e-8 SMART
FN3 165 255 2.21e-3 SMART
Pfam:SPRY 360 480 2e-16 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000163067
SMART Domains Protein: ENSMUSP00000124613
Gene: ENSMUSG00000054752

DomainStartEndE-ValueType
BBC 4 130 4.3e-8 SMART
FN3 165 255 2.21e-3 SMART
Pfam:SPRY 349 469 3.6e-17 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000180164
SMART Domains Protein: ENSMUSP00000136184
Gene: ENSMUSG00000054752

DomainStartEndE-ValueType
BBC 4 130 1.4e-7 SMART
FN3 165 255 2.21e-3 SMART
Pfam:SPRY 350 470 1.2e-16 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T C 13: 58,384,385 Y119C probably damaging Het
Abca12 A T 1: 71,349,155 C185* probably null Het
Abcc3 C T 11: 94,357,047 A1207T probably benign Het
Adam1b T G 5: 121,500,993 D663A probably damaging Het
Arhgap12 A T 18: 6,111,920 L148Q probably damaging Het
Cdh4 A T 2: 179,797,465 Q135L probably benign Het
Clca3b T C 3: 144,837,758 I437V probably benign Het
Cldn15 A T 5: 136,972,473 H124L probably benign Het
Cyp4a30b T C 4: 115,456,651 M143T probably damaging Het
Dgcr2 A T 16: 17,845,080 C353* probably null Het
Dhcr24 T A 4: 106,571,519 probably null Het
Dock1 T G 7: 134,745,008 L223R probably benign Het
Ece1 T A 4: 137,913,763 probably null Het
Efcab5 A G 11: 77,137,344 V387A probably benign Het
Efcab5 A G 11: 77,138,215 F97L possibly damaging Het
Eme2 A T 17: 24,894,569 probably null Het
Enpp1 G A 10: 24,660,161 T447I probably benign Het
Fam222b T C 11: 78,143,181 S17P probably benign Het
Fbln1 A G 15: 85,237,628 I317V probably benign Het
Fn1 T C 1: 71,637,339 K578E probably damaging Het
Fscb A T 12: 64,471,549 S1048T unknown Het
Gm340 A G 19: 41,584,315 K503R possibly damaging Het
Hexa T A 9: 59,563,939 I492K probably benign Het
Inpp5e G A 2: 26,397,858 A642V probably benign Het
Ints11 C T 4: 155,886,111 A241V probably damaging Het
Irs2 A G 8: 11,006,797 L545P probably damaging Het
Katnal2 G A 18: 76,993,575 A409V probably benign Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Lbx2 A G 6: 83,087,896 K138R probably damaging Het
Lpp G A 16: 24,977,279 A558T probably damaging Het
Lypla1 T C 1: 4,841,098 I202T probably benign Het
Magi3 G A 3: 104,034,114 P842S probably benign Het
Meioc G A 11: 102,666,342 V25M probably benign Het
Mthfr C T 4: 148,053,599 T557I probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Olfr1165-ps A T 2: 88,101,705 I94N probably damaging Het
Olfr314 T A 11: 58,786,484 Y83* probably null Het
Osbpl10 A T 9: 115,223,703 I440F probably damaging Het
Otx2 G A 14: 48,661,465 A36V probably benign Het
Parg A G 14: 32,210,508 Y435C probably damaging Het
Parvb A T 15: 84,282,784 D100V possibly damaging Het
Prss27 A G 17: 24,045,691 H276R probably benign Het
Prune1 T A 3: 95,255,046 S439C probably damaging Het
Pudp C G 18: 50,568,216 E149Q possibly damaging Het
Sin3a C A 9: 57,127,299 T1252N possibly damaging Het
Sptbn2 A G 19: 4,737,443 D927G probably benign Het
Stx18 C T 5: 38,104,907 T89I possibly damaging Het
Ticrr T C 7: 79,660,862 S175P possibly damaging Het
Tinag T C 9: 77,045,661 T14A probably benign Het
Tmco3 G A 8: 13,319,605 probably null Het
Trpm1 G T 7: 64,209,981 E396* probably null Het
Txndc11 A G 16: 11,084,299 Y684H probably damaging Het
Usp47 G A 7: 112,093,108 E926K probably benign Het
Vmn1r233 A G 17: 20,993,959 I243T probably damaging Het
Ythdf3 T A 3: 16,203,885 probably null Het
Zfp12 A G 5: 143,244,689 K289R probably damaging Het
Zfp950 T A 19: 61,119,112 H511L probably benign Het
Other mutations in Fsd1l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00975:Fsd1l APN 4 53682187 missense probably damaging 1.00
IGL01019:Fsd1l APN 4 53694742 missense probably damaging 1.00
IGL01154:Fsd1l APN 4 53701074 missense probably benign 0.01
IGL01359:Fsd1l APN 4 53659601 missense possibly damaging 0.78
IGL01996:Fsd1l APN 4 53647760 missense probably benign 0.00
IGL02192:Fsd1l APN 4 53647754 missense probably benign
IGL02629:Fsd1l APN 4 53686417 missense probably damaging 1.00
R0009:Fsd1l UTSW 4 53687209 missense probably benign 0.01
R0166:Fsd1l UTSW 4 53647664 splice site probably null
R0255:Fsd1l UTSW 4 53694727 missense probably damaging 1.00
R0349:Fsd1l UTSW 4 53679854 missense probably damaging 0.97
R0409:Fsd1l UTSW 4 53679932 missense probably benign 0.00
R1886:Fsd1l UTSW 4 53696984 splice site probably null
R1887:Fsd1l UTSW 4 53696984 splice site probably null
R2039:Fsd1l UTSW 4 53679972 missense probably benign 0.02
R2289:Fsd1l UTSW 4 53696931 missense possibly damaging 0.64
R4577:Fsd1l UTSW 4 53686397 missense probably damaging 1.00
R5134:Fsd1l UTSW 4 53647766 missense probably benign 0.43
R6073:Fsd1l UTSW 4 53679994 missense probably damaging 1.00
R6216:Fsd1l UTSW 4 53694742 missense probably damaging 1.00
R7184:Fsd1l UTSW 4 53694054 missense probably damaging 1.00
R7423:Fsd1l UTSW 4 53686406 missense probably damaging 1.00
R7465:Fsd1l UTSW 4 53647755 missense probably benign
Predicted Primers PCR Primer
(F):5'- CTGTGTTCTTCTCAAGTAAAGGG -3'
(R):5'- GCCTAAGGAAAATTCTCCCTTCC -3'

Sequencing Primer
(F):5'- GTGTTCTTCTCAAGTAAAGGGATTTC -3'
(R):5'- TAAGGAAAATTCTCCCTTCCATAGC -3'
Posted On2019-06-26