Incidental Mutation 'R7285:Cyp4a30b'
ID565927
Institutional Source Beutler Lab
Gene Symbol Cyp4a30b
Ensembl Gene ENSMUSG00000084346
Gene Namecytochrome P450, family 4, subfamily a, polypeptide 30b
SynonymsCyp4a30b-ps, OTTMUSG00000008626
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.083) question?
Stock #R7285 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location115452604-115471062 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 115456651 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Threonine at position 143 (M143T)
Ref Sequence ENSEMBL: ENSMUSP00000140857 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000119958]
Predicted Effect probably damaging
Transcript: ENSMUST00000119958
AA Change: M143T

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000140857
Gene: ENSMUSG00000084346
AA Change: M143T

DomainStartEndE-ValueType
transmembrane domain 10 32 N/A INTRINSIC
Pfam:p450 52 503 1.4e-119 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T C 13: 58,384,385 Y119C probably damaging Het
Abca12 A T 1: 71,349,155 C185* probably null Het
Abcc3 C T 11: 94,357,047 A1207T probably benign Het
Adam1b T G 5: 121,500,993 D663A probably damaging Het
Arhgap12 A T 18: 6,111,920 L148Q probably damaging Het
Cdh4 A T 2: 179,797,465 Q135L probably benign Het
Clca3b T C 3: 144,837,758 I437V probably benign Het
Cldn15 A T 5: 136,972,473 H124L probably benign Het
Dgcr2 A T 16: 17,845,080 C353* probably null Het
Dhcr24 T A 4: 106,571,519 probably null Het
Dock1 T G 7: 134,745,008 L223R probably benign Het
Ece1 T A 4: 137,913,763 probably null Het
Efcab5 A G 11: 77,137,344 V387A probably benign Het
Efcab5 A G 11: 77,138,215 F97L possibly damaging Het
Eme2 A T 17: 24,894,569 probably null Het
Enpp1 G A 10: 24,660,161 T447I probably benign Het
Fam222b T C 11: 78,143,181 S17P probably benign Het
Fbln1 A G 15: 85,237,628 I317V probably benign Het
Fn1 T C 1: 71,637,339 K578E probably damaging Het
Fscb A T 12: 64,471,549 S1048T unknown Het
Fsd1l T A 4: 53,682,200 probably null Het
Gm340 A G 19: 41,584,315 K503R possibly damaging Het
Hexa T A 9: 59,563,939 I492K probably benign Het
Inpp5e G A 2: 26,397,858 A642V probably benign Het
Ints11 C T 4: 155,886,111 A241V probably damaging Het
Irs2 A G 8: 11,006,797 L545P probably damaging Het
Katnal2 G A 18: 76,993,575 A409V probably benign Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Lbx2 A G 6: 83,087,896 K138R probably damaging Het
Lpp G A 16: 24,977,279 A558T probably damaging Het
Lypla1 T C 1: 4,841,098 I202T probably benign Het
Magi3 G A 3: 104,034,114 P842S probably benign Het
Meioc G A 11: 102,666,342 V25M probably benign Het
Mthfr C T 4: 148,053,599 T557I probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Olfr1165-ps A T 2: 88,101,705 I94N probably damaging Het
Olfr314 T A 11: 58,786,484 Y83* probably null Het
Osbpl10 A T 9: 115,223,703 I440F probably damaging Het
Otx2 G A 14: 48,661,465 A36V probably benign Het
Parg A G 14: 32,210,508 Y435C probably damaging Het
Parvb A T 15: 84,282,784 D100V possibly damaging Het
Prss27 A G 17: 24,045,691 H276R probably benign Het
Prune1 T A 3: 95,255,046 S439C probably damaging Het
Pudp C G 18: 50,568,216 E149Q possibly damaging Het
Sin3a C A 9: 57,127,299 T1252N possibly damaging Het
Sptbn2 A G 19: 4,737,443 D927G probably benign Het
Stx18 C T 5: 38,104,907 T89I possibly damaging Het
Ticrr T C 7: 79,660,862 S175P possibly damaging Het
Tinag T C 9: 77,045,661 T14A probably benign Het
Tmco3 G A 8: 13,319,605 probably null Het
Trpm1 G T 7: 64,209,981 E396* probably null Het
Txndc11 A G 16: 11,084,299 Y684H probably damaging Het
Usp47 G A 7: 112,093,108 E926K probably benign Het
Vmn1r233 A G 17: 20,993,959 I243T probably damaging Het
Ythdf3 T A 3: 16,203,885 probably null Het
Zfp12 A G 5: 143,244,689 K289R probably damaging Het
Zfp950 T A 19: 61,119,112 H511L probably benign Het
Other mutations in Cyp4a30b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03184:Cyp4a30b APN 4 115459019 missense probably damaging 1.00
IGL03233:Cyp4a30b APN 4 115458970 missense probably benign 0.08
R1394:Cyp4a30b UTSW 4 115470892 critical splice acceptor site probably null
R2870:Cyp4a30b UTSW 4 115458362 missense possibly damaging 0.64
R2870:Cyp4a30b UTSW 4 115458362 missense possibly damaging 0.64
R2871:Cyp4a30b UTSW 4 115458362 missense possibly damaging 0.64
R2871:Cyp4a30b UTSW 4 115458362 missense possibly damaging 0.64
R2872:Cyp4a30b UTSW 4 115458362 missense possibly damaging 0.64
R2872:Cyp4a30b UTSW 4 115458362 missense possibly damaging 0.64
R2873:Cyp4a30b UTSW 4 115458362 missense possibly damaging 0.64
R3818:Cyp4a30b UTSW 4 115459009 missense probably damaging 1.00
R4052:Cyp4a30b UTSW 4 115454342 missense probably benign 0.00
R4684:Cyp4a30b UTSW 4 115455003 missense probably damaging 1.00
R5558:Cyp4a30b UTSW 4 115458866 missense probably damaging 1.00
R5997:Cyp4a30b UTSW 4 115459391 nonsense probably null
R6242:Cyp4a30b UTSW 4 115454390 missense possibly damaging 0.48
R6511:Cyp4a30b UTSW 4 115456708 missense probably damaging 1.00
R6759:Cyp4a30b UTSW 4 115461374 missense probably benign 0.02
R8154:Cyp4a30b UTSW 4 115458296 missense probably benign 0.00
R8314:Cyp4a30b UTSW 4 115458338 missense probably benign 0.00
Z1176:Cyp4a30b UTSW 4 115470959 missense possibly damaging 0.61
Predicted Primers PCR Primer
(F):5'- AATTCTGCCTTCCTCAGAGTTG -3'
(R):5'- TTCATATGCACCTTGAGGGAGG -3'

Sequencing Primer
(F):5'- CCTCAGAGTTGTTTTGCAAATTTC -3'
(R):5'- AGGGGGTGATAGCTAGCTAGTTATC -3'
Posted On2019-06-26