Incidental Mutation 'R7285:Stx18'
ID565930
Institutional Source Beutler Lab
Gene Symbol Stx18
Ensembl Gene ENSMUSG00000029125
Gene Namesyntaxin 18
Synonyms1810035L21Rik, 4933425D03Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7285 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location38038742-38137765 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 38104907 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 89 (T89I)
Ref Sequence ENSEMBL: ENSMUSP00000109761 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031008] [ENSMUST00000042146] [ENSMUST00000114126] [ENSMUST00000146864] [ENSMUST00000154929] [ENSMUST00000202412]
Predicted Effect probably damaging
Transcript: ENSMUST00000031008
AA Change: T89I

PolyPhen 2 Score 0.961 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000031008
Gene: ENSMUSG00000029125
AA Change: T89I

DomainStartEndE-ValueType
Pfam:Syntaxin-18_N 3 96 4.1e-26 PFAM
low complexity region 196 209 N/A INTRINSIC
coiled coil region 229 259 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000042146
AA Change: T89I

PolyPhen 2 Score 0.880 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000038205
Gene: ENSMUSG00000029125
AA Change: T89I

DomainStartEndE-ValueType
Pfam:Syntaxin-18_N 3 96 4.1e-26 PFAM
low complexity region 170 183 N/A INTRINSIC
coiled coil region 203 233 N/A INTRINSIC
transmembrane domain 284 306 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000114126
AA Change: T89I

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000109761
Gene: ENSMUSG00000029125
AA Change: T89I

DomainStartEndE-ValueType
Pfam:Syntaxin-18_N 3 96 3.4e-24 PFAM
low complexity region 196 209 N/A INTRINSIC
coiled coil region 229 259 N/A INTRINSIC
transmembrane domain 310 332 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000146864
AA Change: T8I

PolyPhen 2 Score 0.906 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000143909
Gene: ENSMUSG00000029125
AA Change: T8I

DomainStartEndE-ValueType
low complexity region 115 128 N/A INTRINSIC
coiled coil region 148 178 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000154929
AA Change: T35I

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000118218
Gene: ENSMUSG00000029125
AA Change: T35I

DomainStartEndE-ValueType
low complexity region 142 155 N/A INTRINSIC
coiled coil region 175 205 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000202412
AA Change: T35I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the syntaxin family of soluble N-ethylmaleimide-sensitive factor attachment protein receptors (SNAREs) which is part of a membrane tethering complex that includes other SNAREs and several peripheral membrane proteins, and is involved in vesicular transport between the endoplasmic reticulum (ER) and the Golgi complex. The encoded protein is important for the organization of the smooth, rough, and exit site ER subdomains. A pseudogene of this gene has been identified. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T C 13: 58,384,385 Y119C probably damaging Het
Abca12 A T 1: 71,349,155 C185* probably null Het
Abcc3 C T 11: 94,357,047 A1207T probably benign Het
Adam1b T G 5: 121,500,993 D663A probably damaging Het
Arhgap12 A T 18: 6,111,920 L148Q probably damaging Het
Cdh4 A T 2: 179,797,465 Q135L probably benign Het
Clca3b T C 3: 144,837,758 I437V probably benign Het
Cldn15 A T 5: 136,972,473 H124L probably benign Het
Cyp4a30b T C 4: 115,456,651 M143T probably damaging Het
Dgcr2 A T 16: 17,845,080 C353* probably null Het
Dhcr24 T A 4: 106,571,519 probably null Het
Dock1 T G 7: 134,745,008 L223R probably benign Het
Ece1 T A 4: 137,913,763 probably null Het
Efcab5 A G 11: 77,137,344 V387A probably benign Het
Efcab5 A G 11: 77,138,215 F97L possibly damaging Het
Eme2 A T 17: 24,894,569 probably null Het
Enpp1 G A 10: 24,660,161 T447I probably benign Het
Fam222b T C 11: 78,143,181 S17P probably benign Het
Fbln1 A G 15: 85,237,628 I317V probably benign Het
Fn1 T C 1: 71,637,339 K578E probably damaging Het
Fscb A T 12: 64,471,549 S1048T unknown Het
Fsd1l T A 4: 53,682,200 probably null Het
Gm340 A G 19: 41,584,315 K503R possibly damaging Het
Hexa T A 9: 59,563,939 I492K probably benign Het
Inpp5e G A 2: 26,397,858 A642V probably benign Het
Ints11 C T 4: 155,886,111 A241V probably damaging Het
Irs2 A G 8: 11,006,797 L545P probably damaging Het
Katnal2 G A 18: 76,993,575 A409V probably benign Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Lbx2 A G 6: 83,087,896 K138R probably damaging Het
Lpp G A 16: 24,977,279 A558T probably damaging Het
Lypla1 T C 1: 4,841,098 I202T probably benign Het
Magi3 G A 3: 104,034,114 P842S probably benign Het
Meioc G A 11: 102,666,342 V25M probably benign Het
Mthfr C T 4: 148,053,599 T557I probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Olfr1165-ps A T 2: 88,101,705 I94N probably damaging Het
Olfr314 T A 11: 58,786,484 Y83* probably null Het
Osbpl10 A T 9: 115,223,703 I440F probably damaging Het
Otx2 G A 14: 48,661,465 A36V probably benign Het
Parg A G 14: 32,210,508 Y435C probably damaging Het
Parvb A T 15: 84,282,784 D100V possibly damaging Het
Prss27 A G 17: 24,045,691 H276R probably benign Het
Prune1 T A 3: 95,255,046 S439C probably damaging Het
Pudp C G 18: 50,568,216 E149Q possibly damaging Het
Sin3a C A 9: 57,127,299 T1252N possibly damaging Het
Sptbn2 A G 19: 4,737,443 D927G probably benign Het
Ticrr T C 7: 79,660,862 S175P possibly damaging Het
Tinag T C 9: 77,045,661 T14A probably benign Het
Tmco3 G A 8: 13,319,605 probably null Het
Trpm1 G T 7: 64,209,981 E396* probably null Het
Txndc11 A G 16: 11,084,299 Y684H probably damaging Het
Usp47 G A 7: 112,093,108 E926K probably benign Het
Vmn1r233 A G 17: 20,993,959 I243T probably damaging Het
Ythdf3 T A 3: 16,203,885 probably null Het
Zfp12 A G 5: 143,244,689 K289R probably damaging Het
Zfp950 T A 19: 61,119,112 H511L probably benign Het
Other mutations in Stx18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01782:Stx18 APN 5 38106611 missense possibly damaging 0.86
IGL02123:Stx18 APN 5 38128103 missense probably damaging 1.00
IGL03107:Stx18 APN 5 38136311 missense probably damaging 1.00
IGL03187:Stx18 APN 5 38126983 missense possibly damaging 0.94
R0025:Stx18 UTSW 5 38092564 missense probably damaging 1.00
R0025:Stx18 UTSW 5 38092564 missense probably damaging 1.00
R0414:Stx18 UTSW 5 38105005 splice site probably benign
R0713:Stx18 UTSW 5 38106671 intron probably null
R1147:Stx18 UTSW 5 38126923 splice site probably benign
R1552:Stx18 UTSW 5 38104991 missense probably damaging 0.99
R1725:Stx18 UTSW 5 38135255 missense probably damaging 1.00
R1929:Stx18 UTSW 5 38128039 splice site probably null
R2020:Stx18 UTSW 5 38135244 missense probably damaging 1.00
R4678:Stx18 UTSW 5 38136368 unclassified probably benign
R5247:Stx18 UTSW 5 38106633 missense probably damaging 1.00
R6056:Stx18 UTSW 5 38106564 missense probably damaging 0.96
R6330:Stx18 UTSW 5 38126917 unclassified probably null
R6860:Stx18 UTSW 5 38104891 missense possibly damaging 0.62
R7060:Stx18 UTSW 5 38121255 missense possibly damaging 0.87
R7351:Stx18 UTSW 5 38039411 missense probably benign 0.00
R8310:Stx18 UTSW 5 38128039 splice site probably null
R8329:Stx18 UTSW 5 38128106 nonsense probably null
X0026:Stx18 UTSW 5 38104966 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TCTGTTCCTAGCAAAGCTGTGC -3'
(R):5'- AAGGAATGCTACGTGGCTG -3'

Sequencing Primer
(F):5'- TCGAAGACTGTACCTCATGGC -3'
(R):5'- ATGCTACGTGGCTGCACAATG -3'
Posted On2019-06-26