Incidental Mutation 'R7285:Cldn15'
ID565932
Institutional Source Beutler Lab
Gene Symbol Cldn15
Ensembl Gene ENSMUSG00000001739
Gene Nameclaudin 15
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7285 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location136966616-136975858 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 136972473 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 124 (H124L)
Ref Sequence ENSEMBL: ENSMUSP00000001790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001790] [ENSMUST00000111093]
PDB Structure
Crystal structure of mouse claudin-15 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000001790
AA Change: H124L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000001790
Gene: ENSMUSG00000001739
AA Change: H124L

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 2 179 6.4e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000111093
AA Change: H124L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000106722
Gene: ENSMUSG00000001739
AA Change: H124L

DomainStartEndE-ValueType
Pfam:PMP22_Claudin 2 179 6.5e-36 PFAM
Pfam:Claudin_2 12 181 2.2e-10 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: This gene encodes a member of the claudin family. Claudins are integral membrane proteins and components of tight junction strands. Tight junction strands serve as a physical barrier to prevent solutes and water from passing freely through the paracellular space between epithelial or endothelial cell sheets, and also play critical roles in maintaining cell polarity and signal transductions. This protein increases permeability for sodium ions in anion-selective epithelial cell sheets. The gene deficiency leads to megaintestine and decreases in intestinal epithelial paracellular ion permeability. This gene is a direct target for hepatocyte-nuclear-factor-4alpha, a mediator of ion epithelial transport, and is down-modulated in inflammatory bowel disease. [provided by RefSeq, Aug 2010]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and grow normally with an enlarged upper small intestinal phenotype (megaintestine) resulting from enhanced proliferation of normal cryptic cells after weaning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T C 13: 58,384,385 Y119C probably damaging Het
Abca12 A T 1: 71,349,155 C185* probably null Het
Abcc3 C T 11: 94,357,047 A1207T probably benign Het
Adam1b T G 5: 121,500,993 D663A probably damaging Het
Arhgap12 A T 18: 6,111,920 L148Q probably damaging Het
Cdh4 A T 2: 179,797,465 Q135L probably benign Het
Clca3b T C 3: 144,837,758 I437V probably benign Het
Cyp4a30b T C 4: 115,456,651 M143T probably damaging Het
Dgcr2 A T 16: 17,845,080 C353* probably null Het
Dhcr24 T A 4: 106,571,519 probably null Het
Dock1 T G 7: 134,745,008 L223R probably benign Het
Ece1 T A 4: 137,913,763 probably null Het
Efcab5 A G 11: 77,137,344 V387A probably benign Het
Efcab5 A G 11: 77,138,215 F97L possibly damaging Het
Eme2 A T 17: 24,894,569 probably null Het
Enpp1 G A 10: 24,660,161 T447I probably benign Het
Fam222b T C 11: 78,143,181 S17P probably benign Het
Fbln1 A G 15: 85,237,628 I317V probably benign Het
Fn1 T C 1: 71,637,339 K578E probably damaging Het
Fscb A T 12: 64,471,549 S1048T unknown Het
Fsd1l T A 4: 53,682,200 probably null Het
Gm340 A G 19: 41,584,315 K503R possibly damaging Het
Hexa T A 9: 59,563,939 I492K probably benign Het
Inpp5e G A 2: 26,397,858 A642V probably benign Het
Ints11 C T 4: 155,886,111 A241V probably damaging Het
Irs2 A G 8: 11,006,797 L545P probably damaging Het
Katnal2 G A 18: 76,993,575 A409V probably benign Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Lbx2 A G 6: 83,087,896 K138R probably damaging Het
Lpp G A 16: 24,977,279 A558T probably damaging Het
Lypla1 T C 1: 4,841,098 I202T probably benign Het
Magi3 G A 3: 104,034,114 P842S probably benign Het
Meioc G A 11: 102,666,342 V25M probably benign Het
Mthfr C T 4: 148,053,599 T557I probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Olfr1165-ps A T 2: 88,101,705 I94N probably damaging Het
Olfr314 T A 11: 58,786,484 Y83* probably null Het
Osbpl10 A T 9: 115,223,703 I440F probably damaging Het
Otx2 G A 14: 48,661,465 A36V probably benign Het
Parg A G 14: 32,210,508 Y435C probably damaging Het
Parvb A T 15: 84,282,784 D100V possibly damaging Het
Prss27 A G 17: 24,045,691 H276R probably benign Het
Prune1 T A 3: 95,255,046 S439C probably damaging Het
Pudp C G 18: 50,568,216 E149Q possibly damaging Het
Sin3a C A 9: 57,127,299 T1252N possibly damaging Het
Sptbn2 A G 19: 4,737,443 D927G probably benign Het
Stx18 C T 5: 38,104,907 T89I possibly damaging Het
Ticrr T C 7: 79,660,862 S175P possibly damaging Het
Tinag T C 9: 77,045,661 T14A probably benign Het
Tmco3 G A 8: 13,319,605 probably null Het
Trpm1 G T 7: 64,209,981 E396* probably null Het
Txndc11 A G 16: 11,084,299 Y684H probably damaging Het
Usp47 G A 7: 112,093,108 E926K probably benign Het
Vmn1r233 A G 17: 20,993,959 I243T probably damaging Het
Ythdf3 T A 3: 16,203,885 probably null Het
Zfp12 A G 5: 143,244,689 K289R probably damaging Het
Zfp950 T A 19: 61,119,112 H511L probably benign Het
Other mutations in Cldn15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02706:Cldn15 APN 5 136974831 missense probably benign 0.00
R0395:Cldn15 UTSW 5 136968198 missense possibly damaging 0.91
R2112:Cldn15 UTSW 5 136968162 missense possibly damaging 0.93
R4647:Cldn15 UTSW 5 136974483 missense probably damaging 1.00
R6383:Cldn15 UTSW 5 136968125 missense probably benign 0.07
R6576:Cldn15 UTSW 5 136974616 missense probably damaging 1.00
R6596:Cldn15 UTSW 5 136974679 nonsense probably null
R7721:Cldn15 UTSW 5 136968161 missense probably benign 0.21
R7956:Cldn15 UTSW 5 136974650 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCTAGGAGTTTCAGGTGC -3'
(R):5'- AACCCTACCTTCGACAGTGAG -3'

Sequencing Primer
(F):5'- TTTCAGGTGCAAGAGACCAGC -3'
(R):5'- CCTACCTTCGACAGTGAGTTGTG -3'
Posted On2019-06-26