Mutagenetix > Incidental Mutation

Incidental Mutation 'R7285:Ticrr'

565936

Institutional Source

Beutler Lab

Gene Symbol

Ticrr

Ensembl Gene

ENSMUSG00000046591

Gene Name

TOPBP1-interacting checkpoint and replication regulator

Synonyms

5730590G19Rik

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.953) question?

Stock #

R7285 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

79660196-79698148 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 79660862 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Proline at position 175 (S175P)

Ref Sequence

ENSEMBL: ENSMUSP00000041377 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000035977] [ENSMUST00000206017] [ENSMUST00000206591] [ENSMUST00000206622]

AlphaFold

Q8BQ33

Predicted Effect

possibly damaging
Transcript: ENSMUST00000035977
AA Change: S175P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000041377
Gene: ENSMUSG00000046591
AA Change: S175P

Domain	Start	End	E-Value	Type
low complexity region	23	31	N/A	INTRINSIC
Pfam:Treslin_N	211	1005	N/A	PFAM
low complexity region	1186	1197	N/A	INTRINSIC
low complexity region	1220	1235	N/A	INTRINSIC
low complexity region	1339	1359	N/A	INTRINSIC
low complexity region	1472	1480	N/A	INTRINSIC
low complexity region	1496	1514	N/A	INTRINSIC
low complexity region	1630	1643	N/A	INTRINSIC
low complexity region	1694	1707	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000206017
AA Change: S175P

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)

Predicted Effect

probably damaging
Transcript: ENSMUST00000206591
AA Change: S175P

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)

Predicted Effect

possibly damaging
Transcript: ENSMUST00000206622
AA Change: S175P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)

Meta Mutation Damage Score

0.0767

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.7%
20x: 98.9%

Validation Efficiency

100% (58/58)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Treslin is involved in the initiation of DNA replication (Kumagai et al., 2010 [PubMed 20116089]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Mice homozygous for an ENU-induced allele are mostly hairless, with only a light patch of hair around the face and tail. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 57 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2210016F16Rik	T	C	13: 58,384,385	Y119C	probably damaging	Het
Abca12	A	T	1: 71,349,155	C185*	probably null	Het
Abcc3	C	T	11: 94,357,047	A1207T	probably benign	Het
Adam1b	T	G	5: 121,500,993	D663A	probably damaging	Het
Arhgap12	A	T	18: 6,111,920	L148Q	probably damaging	Het
Cdh4	A	T	2: 179,797,465	Q135L	probably benign	Het
Clca3b	T	C	3: 144,837,758	I437V	probably benign	Het
Cldn15	A	T	5: 136,972,473	H124L	probably benign	Het
Cyp4a30b	T	C	4: 115,456,651	M143T	probably damaging	Het
Dgcr2	A	T	16: 17,845,080	C353*	probably null	Het
Dhcr24	T	A	4: 106,571,519		probably null	Het
Dock1	T	G	7: 134,745,008	L223R	probably benign	Het
Ece1	T	A	4: 137,913,763		probably null	Het
Efcab5	A	G	11: 77,137,344	V387A	probably benign	Het
Efcab5	A	G	11: 77,138,215	F97L	possibly damaging	Het
Eme2	A	T	17: 24,894,569		probably null	Het
Enpp1	G	A	10: 24,660,161	T447I	probably benign	Het
Fam222b	T	C	11: 78,143,181	S17P	probably benign	Het
Fbln1	A	G	15: 85,237,628	I317V	probably benign	Het
Fn1	T	C	1: 71,637,339	K578E	probably damaging	Het
Fscb	A	T	12: 64,471,549	S1048T	unknown	Het
Fsd1l	T	A	4: 53,682,200		probably null	Het
Gm340	A	G	19: 41,584,315	K503R	possibly damaging	Het
Hexa	T	A	9: 59,563,939	I492K	probably benign	Het
Inpp5e	G	A	2: 26,397,858	A642V	probably benign	Het
Ints11	C	T	4: 155,886,111	A241V	probably damaging	Het
Irs2	A	G	8: 11,006,797	L545P	probably damaging	Het
Katnal2	G	A	18: 76,993,575	A409V	probably benign	Het
Kif13a	C	T	13: 46,752,455	V671M	possibly damaging	Het
Lbx2	A	G	6: 83,087,896	K138R	probably damaging	Het
Lpp	G	A	16: 24,977,279	A558T	probably damaging	Het
Lypla1	T	C	1: 4,841,098	I202T	probably benign	Het
Magi3	G	A	3: 104,034,114	P842S	probably benign	Het
Meioc	G	A	11: 102,666,342	V25M	probably benign	Het
Mthfr	C	T	4: 148,053,599	T557I	probably benign	Het
Nbeal1	G	C	1: 60,237,151	V684L	probably benign	Het
Olfr1165-ps	A	T	2: 88,101,705	I94N	probably damaging	Het
Olfr314	T	A	11: 58,786,484	Y83*	probably null	Het
Osbpl10	A	T	9: 115,223,703	I440F	probably damaging	Het
Otx2	G	A	14: 48,661,465	A36V	probably benign	Het
Parg	A	G	14: 32,210,508	Y435C	probably damaging	Het
Parvb	A	T	15: 84,282,784	D100V	possibly damaging	Het
Prss27	A	G	17: 24,045,691	H276R	probably benign	Het
Prune1	T	A	3: 95,255,046	S439C	probably damaging	Het
Pudp	C	G	18: 50,568,216	E149Q	possibly damaging	Het
Sin3a	C	A	9: 57,127,299	T1252N	possibly damaging	Het
Sptbn2	A	G	19: 4,737,443	D927G	probably benign	Het
Stx18	C	T	5: 38,104,907	T89I	possibly damaging	Het
Tinag	T	C	9: 77,045,661	T14A	probably benign	Het
Tmco3	G	A	8: 13,319,605		probably null	Het
Trpm1	G	T	7: 64,209,981	E396*	probably null	Het
Txndc11	A	G	16: 11,084,299	Y684H	probably damaging	Het
Usp47	G	A	7: 112,093,108	E926K	probably benign	Het
Vmn1r233	A	G	17: 20,993,959	I243T	probably damaging	Het
Ythdf3	T	A	3: 16,203,885		probably null	Het
Zfp12	A	G	5: 143,244,689	K289R	probably damaging	Het
Zfp950	T	A	19: 61,119,112	H511L	probably benign	Het

Other mutations in Ticrr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00087:Ticrr	APN	7	79677283	missense	probably damaging	1.00
IGL00596:Ticrr	APN	7	79677293	missense	probably damaging	1.00
IGL01327:Ticrr	APN	7	79694461	missense	probably benign	0.00
IGL01525:Ticrr	APN	7	79682449	missense	probably damaging	1.00
IGL01565:Ticrr	APN	7	79694548	missense	probably benign
IGL01936:Ticrr	APN	7	79694549	missense	probably benign	0.11
IGL02160:Ticrr	APN	7	79694019	missense	probably benign	0.29
IGL02246:Ticrr	APN	7	79675328	missense	probably damaging	1.00
IGL02487:Ticrr	APN	7	79683021	missense	possibly damaging	0.86
IGL02593:Ticrr	APN	7	79695466	missense	probably damaging	0.99
IGL02970:Ticrr	APN	7	79695171	missense	probably benign	0.01
FR4304:Ticrr	UTSW	7	79694311	intron	probably benign
PIT4305001:Ticrr	UTSW	7	79679023	missense	possibly damaging	0.95
PIT4791001:Ticrr	UTSW	7	79669638	missense	possibly damaging	0.92
R0016:Ticrr	UTSW	7	79693792	missense	probably benign	0.01
R0062:Ticrr	UTSW	7	79667906	missense	probably benign	0.01
R0062:Ticrr	UTSW	7	79667906	missense	probably benign	0.01
R0067:Ticrr	UTSW	7	79677410	missense	probably damaging	1.00
R0067:Ticrr	UTSW	7	79677410	missense	probably damaging	1.00
R0362:Ticrr	UTSW	7	79677340	missense	probably damaging	1.00
R0482:Ticrr	UTSW	7	79694488	missense	probably damaging	0.99
R0595:Ticrr	UTSW	7	79695563	missense	possibly damaging	0.94
R1118:Ticrr	UTSW	7	79693953	missense	probably benign	0.23
R1119:Ticrr	UTSW	7	79693953	missense	probably benign	0.23
R1572:Ticrr	UTSW	7	79681824	missense	probably damaging	1.00
R1658:Ticrr	UTSW	7	79695549	missense	possibly damaging	0.57
R1757:Ticrr	UTSW	7	79675323	missense	probably damaging	0.99
R1757:Ticrr	UTSW	7	79679046	nonsense	probably null
R1862:Ticrr	UTSW	7	79695207	missense	probably damaging	1.00
R1869:Ticrr	UTSW	7	79679135	missense	probably damaging	1.00
R1938:Ticrr	UTSW	7	79675394	missense	probably damaging	0.98
R1966:Ticrr	UTSW	7	79694735	nonsense	probably null
R2006:Ticrr	UTSW	7	79694073	missense	possibly damaging	0.93
R2178:Ticrr	UTSW	7	79665685	missense	probably benign	0.12
R3404:Ticrr	UTSW	7	79694791	missense	probably benign	0.06
R3405:Ticrr	UTSW	7	79694791	missense	probably benign	0.06
R3941:Ticrr	UTSW	7	79693697	intron	probably benign
R3950:Ticrr	UTSW	7	79682069	missense	probably damaging	1.00
R3951:Ticrr	UTSW	7	79682069	missense	probably damaging	1.00
R3952:Ticrr	UTSW	7	79682069	missense	probably damaging	1.00
R4967:Ticrr	UTSW	7	79660410	missense	probably damaging	0.99
R4972:Ticrr	UTSW	7	79669668	missense	probably damaging	0.98
R5259:Ticrr	UTSW	7	79694723	missense	probably benign	0.01
R5272:Ticrr	UTSW	7	79669605	missense	probably benign	0.44
R5374:Ticrr	UTSW	7	79690942	nonsense	probably null
R5480:Ticrr	UTSW	7	79660809	missense	probably damaging	1.00
R5568:Ticrr	UTSW	7	79689967	critical splice donor site	probably null
R5568:Ticrr	UTSW	7	79695296	nonsense	probably null
R5588:Ticrr	UTSW	7	79679105	missense	probably damaging	1.00
R5698:Ticrr	UTSW	7	79679133	missense	probably benign
R5879:Ticrr	UTSW	7	79696690	missense	probably benign	0.12
R5980:Ticrr	UTSW	7	79660955	missense	probably damaging	0.99
R6128:Ticrr	UTSW	7	79693968	missense	probably damaging	1.00
R6277:Ticrr	UTSW	7	79694696	missense	probably benign	0.00
R6335:Ticrr	UTSW	7	79694283	splice site	probably null
R6866:Ticrr	UTSW	7	79693957	missense	possibly damaging	0.47
R6905:Ticrr	UTSW	7	79665850	missense	probably benign	0.00
R6923:Ticrr	UTSW	7	79691853	missense	probably damaging	0.98
R6962:Ticrr	UTSW	7	79665897	missense	possibly damaging	0.84
R7232:Ticrr	UTSW	7	79693742	missense	probably damaging	0.96
R7385:Ticrr	UTSW	7	79691849	missense	possibly damaging	0.93
R7426:Ticrr	UTSW	7	79693986	missense	probably benign
R7583:Ticrr	UTSW	7	79696739	nonsense	probably null
R7749:Ticrr	UTSW	7	79679096	missense	possibly damaging	0.94
R7863:Ticrr	UTSW	7	79682012	missense	possibly damaging	0.92
R7899:Ticrr	UTSW	7	79669485	missense	probably benign	0.23
R7935:Ticrr	UTSW	7	79681836	missense	probably damaging	0.99
R8005:Ticrr	UTSW	7	79694048	missense	probably damaging	0.98
R8080:Ticrr	UTSW	7	79684264	splice site	probably null
R8181:Ticrr	UTSW	7	79660980	missense	possibly damaging	0.92
R8349:Ticrr	UTSW	7	79694680	missense	probably benign	0.27
R8410:Ticrr	UTSW	7	79667675	missense	probably damaging	0.98
R8449:Ticrr	UTSW	7	79694680	missense	probably benign	0.27
R9073:Ticrr	UTSW	7	79667931	missense	probably benign	0.01
R9090:Ticrr	UTSW	7	79660856	missense	possibly damaging	0.85
R9271:Ticrr	UTSW	7	79660856	missense	possibly damaging	0.85
R9287:Ticrr	UTSW	7	79693768	missense	possibly damaging	0.89
R9368:Ticrr	UTSW	7	79680987	missense	probably damaging	0.99
R9469:Ticrr	UTSW	7	79694763	missense	probably benign	0.03
R9502:Ticrr	UTSW	7	79693849	missense	probably benign
R9614:Ticrr	UTSW	7	79696006	missense	probably damaging	1.00
R9761:Ticrr	UTSW	7	79695565	missense	probably damaging	1.00
R9779:Ticrr	UTSW	7	79679054	missense	probably benign	0.37

Predicted Primers

PCR Primer
(F):5'- AAGTTCTTCGACTCTCAGGGG -3'
(R):5'- TGACAAGTTCAGCTGTCGG -3'

Sequencing Primer
(F):5'- ATGGAGACGCTGCTCGACTAC -3'
(R):5'- CAGCTGTCGGGGAGTTGC -3'

Posted On

2019-06-26