Incidental Mutation 'R7285:Irs2'
ID565939
Institutional Source Beutler Lab
Gene Symbol Irs2
Ensembl Gene ENSMUSG00000038894
Gene Nameinsulin receptor substrate 2
SynonymsIrs-2
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.474) question?
Stock #R7285 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location10984681-11008458 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 11006797 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 545 (L545P)
Ref Sequence ENSEMBL: ENSMUSP00000038514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040514]
PDB Structure
Crystal structure of the insulin receptor kinase in complex with IRS2 KRLB peptide [X-RAY DIFFRACTION]
Crystal structure of the insulin receptor kinase in complex with IRS2 KRLB peptide and ATP [X-RAY DIFFRACTION]
Crystal structure of the insulin receptor kinase in complex with IRS2 KRLB phosphopeptide [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000040514
AA Change: L545P

PolyPhen 2 Score 0.994 (Sensitivity: 0.69; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000038514
Gene: ENSMUSG00000038894
AA Change: L545P

DomainStartEndE-ValueType
low complexity region 2 18 N/A INTRINSIC
low complexity region 19 28 N/A INTRINSIC
PH 31 146 2.83e-13 SMART
IRS 191 293 4.98e-38 SMART
PTBI 191 293 2.24e-51 SMART
low complexity region 301 309 N/A INTRINSIC
low complexity region 364 377 N/A INTRINSIC
low complexity region 435 473 N/A INTRINSIC
low complexity region 478 490 N/A INTRINSIC
low complexity region 688 710 N/A INTRINSIC
low complexity region 721 730 N/A INTRINSIC
low complexity region 834 846 N/A INTRINSIC
low complexity region 923 959 N/A INTRINSIC
low complexity region 976 984 N/A INTRINSIC
low complexity region 997 1028 N/A INTRINSIC
low complexity region 1137 1154 N/A INTRINSIC
low complexity region 1191 1208 N/A INTRINSIC
low complexity region 1274 1296 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the insulin receptor substrate 2, a cytoplasmic signaling molecule that mediates effects of insulin, insulin-like growth factor 1, and other cytokines by acting as a molecular adaptor between diverse receptor tyrosine kinases and downstream effectors. The product of this gene is phosphorylated by the insulin receptor tyrosine kinase upon receptor stimulation, as well as by an interleukin 4 receptor-associated kinase in response to IL4 treatment. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous disruption of this gene results in type 2 diabetes due to insulin resistance and pancreatic beta cell dysfunction, causes defects in leptin action, energy balance, lipid homeostasis and vascular wound healing, and leads to female infertility due to hypothalamic and ovarian dysfunction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T C 13: 58,384,385 Y119C probably damaging Het
Abca12 A T 1: 71,349,155 C185* probably null Het
Abcc3 C T 11: 94,357,047 A1207T probably benign Het
Adam1b T G 5: 121,500,993 D663A probably damaging Het
Arhgap12 A T 18: 6,111,920 L148Q probably damaging Het
Cdh4 A T 2: 179,797,465 Q135L probably benign Het
Clca3b T C 3: 144,837,758 I437V probably benign Het
Cldn15 A T 5: 136,972,473 H124L probably benign Het
Cyp4a30b T C 4: 115,456,651 M143T probably damaging Het
Dgcr2 A T 16: 17,845,080 C353* probably null Het
Dhcr24 T A 4: 106,571,519 probably null Het
Dock1 T G 7: 134,745,008 L223R probably benign Het
Ece1 T A 4: 137,913,763 probably null Het
Efcab5 A G 11: 77,137,344 V387A probably benign Het
Efcab5 A G 11: 77,138,215 F97L possibly damaging Het
Eme2 A T 17: 24,894,569 probably null Het
Enpp1 G A 10: 24,660,161 T447I probably benign Het
Fam222b T C 11: 78,143,181 S17P probably benign Het
Fbln1 A G 15: 85,237,628 I317V probably benign Het
Fn1 T C 1: 71,637,339 K578E probably damaging Het
Fscb A T 12: 64,471,549 S1048T unknown Het
Fsd1l T A 4: 53,682,200 probably null Het
Gm340 A G 19: 41,584,315 K503R possibly damaging Het
Hexa T A 9: 59,563,939 I492K probably benign Het
Inpp5e G A 2: 26,397,858 A642V probably benign Het
Ints11 C T 4: 155,886,111 A241V probably damaging Het
Katnal2 G A 18: 76,993,575 A409V probably benign Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Lbx2 A G 6: 83,087,896 K138R probably damaging Het
Lpp G A 16: 24,977,279 A558T probably damaging Het
Lypla1 T C 1: 4,841,098 I202T probably benign Het
Magi3 G A 3: 104,034,114 P842S probably benign Het
Meioc G A 11: 102,666,342 V25M probably benign Het
Mthfr C T 4: 148,053,599 T557I probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Olfr1165-ps A T 2: 88,101,705 I94N probably damaging Het
Olfr314 T A 11: 58,786,484 Y83* probably null Het
Osbpl10 A T 9: 115,223,703 I440F probably damaging Het
Otx2 G A 14: 48,661,465 A36V probably benign Het
Parg A G 14: 32,210,508 Y435C probably damaging Het
Parvb A T 15: 84,282,784 D100V possibly damaging Het
Prss27 A G 17: 24,045,691 H276R probably benign Het
Prune1 T A 3: 95,255,046 S439C probably damaging Het
Pudp C G 18: 50,568,216 E149Q possibly damaging Het
Sin3a C A 9: 57,127,299 T1252N possibly damaging Het
Sptbn2 A G 19: 4,737,443 D927G probably benign Het
Stx18 C T 5: 38,104,907 T89I possibly damaging Het
Ticrr T C 7: 79,660,862 S175P possibly damaging Het
Tinag T C 9: 77,045,661 T14A probably benign Het
Tmco3 G A 8: 13,319,605 probably null Het
Trpm1 G T 7: 64,209,981 E396* probably null Het
Txndc11 A G 16: 11,084,299 Y684H probably damaging Het
Usp47 G A 7: 112,093,108 E926K probably benign Het
Vmn1r233 A G 17: 20,993,959 I243T probably damaging Het
Ythdf3 T A 3: 16,203,885 probably null Het
Zfp12 A G 5: 143,244,689 K289R probably damaging Het
Zfp950 T A 19: 61,119,112 H511L probably benign Het
Other mutations in Irs2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Irs2 APN 8 11005867 missense probably benign 0.00
IGL01328:Irs2 APN 8 11004792 missense probably damaging 0.99
IGL01875:Irs2 APN 8 11006221 missense probably damaging 0.98
IGL02444:Irs2 APN 8 11006306 missense probably benign 0.03
IGL02448:Irs2 APN 8 11007862 missense probably benign 0.21
IGL02945:Irs2 APN 8 11007781 missense probably damaging 1.00
IGL03068:Irs2 APN 8 11004974 missense probably damaging 0.99
beefed UTSW 8 11006522 nonsense probably null
Dum_dum UTSW 8 10987012 makesense probably null
Lush UTSW 8 11006678 nonsense probably null
muscular UTSW 8 11004659 nonsense probably null
R0062:Irs2 UTSW 8 11005723 missense possibly damaging 0.65
R0062:Irs2 UTSW 8 11005723 missense possibly damaging 0.65
R0107:Irs2 UTSW 8 11004691 missense probably damaging 1.00
R0147:Irs2 UTSW 8 11007568 missense probably damaging 1.00
R0501:Irs2 UTSW 8 11006396 missense probably damaging 1.00
R0565:Irs2 UTSW 8 11004592 missense probably damaging 0.98
R2042:Irs2 UTSW 8 11007580 missense probably damaging 0.99
R2268:Irs2 UTSW 8 11007586 missense probably damaging 0.98
R2518:Irs2 UTSW 8 11005352 missense probably benign 0.00
R2762:Irs2 UTSW 8 11006408 missense probably damaging 1.00
R3623:Irs2 UTSW 8 11007643 missense probably damaging 1.00
R3624:Irs2 UTSW 8 11007643 missense probably damaging 1.00
R5022:Irs2 UTSW 8 10987012 makesense probably null
R5270:Irs2 UTSW 8 11006678 nonsense probably null
R5377:Irs2 UTSW 8 11005277 missense probably benign 0.00
R5604:Irs2 UTSW 8 11005007 missense possibly damaging 0.84
R6049:Irs2 UTSW 8 11006805 missense probably benign 0.01
R6219:Irs2 UTSW 8 11005121 missense probably damaging 0.99
R6654:Irs2 UTSW 8 11006486 missense probably damaging 1.00
R6726:Irs2 UTSW 8 11004961 missense possibly damaging 0.86
R6813:Irs2 UTSW 8 11004659 nonsense probably null
R6934:Irs2 UTSW 8 11004697 missense probably damaging 0.99
R7261:Irs2 UTSW 8 11007018 missense possibly damaging 0.95
R7458:Irs2 UTSW 8 11007739 missense probably damaging 0.99
R7757:Irs2 UTSW 8 11006522 nonsense probably null
R8347:Irs2 UTSW 8 11008000 missense possibly damaging 0.82
R8377:Irs2 UTSW 8 11004848 nonsense probably null
Z1176:Irs2 UTSW 8 11006185 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GAAGGTGGCCCTCATGAGAG -3'
(R):5'- CGAGCAAAGTGACTCTGGCG -3'

Sequencing Primer
(F):5'- GCCCTCATGAGAGTGTATTCATCTAG -3'
(R):5'- ACAGCCGCTCCATGTCCATG -3'
Posted On2019-06-26