Incidental Mutation 'R7285:Sin3a'
ID565940
Institutional Source Beutler Lab
Gene Symbol Sin3a
Ensembl Gene ENSMUSG00000042557
Gene Nametranscriptional regulator, SIN3A (yeast)
SynonymsSin3, mSin3A
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7285 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location57072040-57128366 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 57127299 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Asparagine at position 1252 (T1252N)
Ref Sequence ENSEMBL: ENSMUSP00000130221 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034836] [ENSMUST00000049169] [ENSMUST00000159130] [ENSMUST00000160147] [ENSMUST00000160584] [ENSMUST00000161182] [ENSMUST00000161393] [ENSMUST00000161663] [ENSMUST00000162915] [ENSMUST00000167715] [ENSMUST00000168177] [ENSMUST00000168502] [ENSMUST00000168678]
Predicted Effect probably benign
Transcript: ENSMUST00000034836
SMART Domains Protein: ENSMUSP00000034836
Gene: ENSMUSG00000032295

DomainStartEndE-ValueType
low complexity region 187 195 N/A INTRINSIC
Pfam:Glyco_hydro_38 251 510 4.3e-89 PFAM
Alpha-mann_mid 516 593 1.37e-26 SMART
low complexity region 603 613 N/A INTRINSIC
Pfam:Glyco_hydro_38C 619 1029 1.3e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000049169
AA Change: T1249N

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000045044
Gene: ENSMUSG00000042557
AA Change: T1249N

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 141 187 1.4e-19 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 322 381 1.8e-23 PFAM
Pfam:PAH 478 524 4e-16 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
low complexity region 915 930 N/A INTRINSIC
low complexity region 1135 1151 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000159130
Predicted Effect probably benign
Transcript: ENSMUST00000160147
SMART Domains Protein: ENSMUSP00000125478
Gene: ENSMUSG00000032295

DomainStartEndE-ValueType
low complexity region 187 195 N/A INTRINSIC
Pfam:Glyco_hydro_38 251 510 2.8e-86 PFAM
Alpha-mann_mid 516 595 1.22e-32 SMART
low complexity region 605 615 N/A INTRINSIC
Pfam:Glyco_hydro_38C 621 1031 1.2e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000160584
SMART Domains Protein: ENSMUSP00000123840
Gene: ENSMUSG00000032295

DomainStartEndE-ValueType
low complexity region 187 195 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161182
SMART Domains Protein: ENSMUSP00000124020
Gene: ENSMUSG00000032295

DomainStartEndE-ValueType
Pfam:Glyco_hydro_38 175 411 9.4e-67 PFAM
Alpha-mann_mid 417 496 1.22e-32 SMART
low complexity region 506 516 N/A INTRINSIC
Pfam:Glyco_hydro_38C 522 932 1.1e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000161393
Predicted Effect probably benign
Transcript: ENSMUST00000161663
SMART Domains Protein: ENSMUSP00000124124
Gene: ENSMUSG00000032295

DomainStartEndE-ValueType
low complexity region 187 195 N/A INTRINSIC
Pfam:Glyco_hydro_38 302 551 1.8e-81 PFAM
Alpha-mann_mid 557 636 1.22e-32 SMART
low complexity region 646 656 N/A INTRINSIC
Pfam:Glyco_hydro_38C 662 866 1.2e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162915
Predicted Effect probably benign
Transcript: ENSMUST00000167715
AA Change: T1249N

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000130641
Gene: ENSMUSG00000042557
AA Change: T1249N

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 141 187 1.4e-19 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 322 381 1.8e-23 PFAM
Pfam:PAH 478 524 4e-16 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
low complexity region 915 930 N/A INTRINSIC
low complexity region 1135 1151 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000168177
AA Change: T1252N

PolyPhen 2 Score 0.566 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000130221
Gene: ENSMUSG00000042557
AA Change: T1252N

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 142 186 5.3e-22 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 323 380 9.6e-22 PFAM
Pfam:PAH 479 523 8.1e-11 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
Pfam:Sin3a_C 887 1190 1.2e-93 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000168502
AA Change: T1252N

PolyPhen 2 Score 0.566 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000128956
Gene: ENSMUSG00000042557
AA Change: T1252N

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 141 187 1.4e-19 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 322 381 1.8e-23 PFAM
Pfam:PAH 478 524 4e-16 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
low complexity region 915 930 N/A INTRINSIC
low complexity region 1138 1154 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168678
AA Change: T1249N

PolyPhen 2 Score 0.047 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000126601
Gene: ENSMUSG00000042557
AA Change: T1249N

DomainStartEndE-ValueType
low complexity region 98 119 N/A INTRINSIC
Pfam:PAH 141 187 1.4e-19 PFAM
low complexity region 217 248 N/A INTRINSIC
low complexity region 267 282 N/A INTRINSIC
Pfam:PAH 322 381 1.8e-23 PFAM
Pfam:PAH 478 524 4e-16 PFAM
HDAC_interact 551 651 3.31e-61 SMART
low complexity region 834 847 N/A INTRINSIC
low complexity region 915 930 N/A INTRINSIC
low complexity region 1135 1151 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a transcriptional regulatory protein. It contains paired amphipathic helix (PAH) domains, which are important for protein-protein interactions and may mediate repression by the Mad-Max complex. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene results in early embryonic lethality. Homozygous null MEFs display poor cell proliferation, reduced S-phase and increased G2/M fractions, a block in DNA replication, and enhanced apoptosis; however, no increase in chromosomal instability is observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T C 13: 58,384,385 Y119C probably damaging Het
Abca12 A T 1: 71,349,155 C185* probably null Het
Abcc3 C T 11: 94,357,047 A1207T probably benign Het
Adam1b T G 5: 121,500,993 D663A probably damaging Het
Arhgap12 A T 18: 6,111,920 L148Q probably damaging Het
Cdh4 A T 2: 179,797,465 Q135L probably benign Het
Clca3b T C 3: 144,837,758 I437V probably benign Het
Cldn15 A T 5: 136,972,473 H124L probably benign Het
Cyp4a30b T C 4: 115,456,651 M143T probably damaging Het
Dgcr2 A T 16: 17,845,080 C353* probably null Het
Dhcr24 T A 4: 106,571,519 probably null Het
Dock1 T G 7: 134,745,008 L223R probably benign Het
Ece1 T A 4: 137,913,763 probably null Het
Efcab5 A G 11: 77,137,344 V387A probably benign Het
Efcab5 A G 11: 77,138,215 F97L possibly damaging Het
Eme2 A T 17: 24,894,569 probably null Het
Enpp1 G A 10: 24,660,161 T447I probably benign Het
Fam222b T C 11: 78,143,181 S17P probably benign Het
Fbln1 A G 15: 85,237,628 I317V probably benign Het
Fn1 T C 1: 71,637,339 K578E probably damaging Het
Fscb A T 12: 64,471,549 S1048T unknown Het
Fsd1l T A 4: 53,682,200 probably null Het
Gm340 A G 19: 41,584,315 K503R possibly damaging Het
Hexa T A 9: 59,563,939 I492K probably benign Het
Inpp5e G A 2: 26,397,858 A642V probably benign Het
Ints11 C T 4: 155,886,111 A241V probably damaging Het
Irs2 A G 8: 11,006,797 L545P probably damaging Het
Katnal2 G A 18: 76,993,575 A409V probably benign Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Lbx2 A G 6: 83,087,896 K138R probably damaging Het
Lpp G A 16: 24,977,279 A558T probably damaging Het
Lypla1 T C 1: 4,841,098 I202T probably benign Het
Magi3 G A 3: 104,034,114 P842S probably benign Het
Meioc G A 11: 102,666,342 V25M probably benign Het
Mthfr C T 4: 148,053,599 T557I probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Olfr1165-ps A T 2: 88,101,705 I94N probably damaging Het
Olfr314 T A 11: 58,786,484 Y83* probably null Het
Osbpl10 A T 9: 115,223,703 I440F probably damaging Het
Otx2 G A 14: 48,661,465 A36V probably benign Het
Parg A G 14: 32,210,508 Y435C probably damaging Het
Parvb A T 15: 84,282,784 D100V possibly damaging Het
Prss27 A G 17: 24,045,691 H276R probably benign Het
Prune1 T A 3: 95,255,046 S439C probably damaging Het
Pudp C G 18: 50,568,216 E149Q possibly damaging Het
Sptbn2 A G 19: 4,737,443 D927G probably benign Het
Stx18 C T 5: 38,104,907 T89I possibly damaging Het
Ticrr T C 7: 79,660,862 S175P possibly damaging Het
Tinag T C 9: 77,045,661 T14A probably benign Het
Tmco3 G A 8: 13,319,605 probably null Het
Trpm1 G T 7: 64,209,981 E396* probably null Het
Txndc11 A G 16: 11,084,299 Y684H probably damaging Het
Usp47 G A 7: 112,093,108 E926K probably benign Het
Vmn1r233 A G 17: 20,993,959 I243T probably damaging Het
Ythdf3 T A 3: 16,203,885 probably null Het
Zfp12 A G 5: 143,244,689 K289R probably damaging Het
Zfp950 T A 19: 61,119,112 H511L probably benign Het
Other mutations in Sin3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Sin3a APN 9 57097901 missense probably damaging 1.00
IGL00836:Sin3a APN 9 57107345 splice site probably null
IGL00913:Sin3a APN 9 57098118 missense probably benign 0.01
IGL01721:Sin3a APN 9 57095325 missense probably damaging 1.00
IGL01964:Sin3a APN 9 57107347 splice site probably benign
IGL02333:Sin3a APN 9 57107559 missense possibly damaging 0.86
IGL02673:Sin3a APN 9 57107441 missense probably damaging 0.99
Delicate UTSW 9 57103929 missense probably damaging 1.00
IGL03014:Sin3a UTSW 9 57095255 intron probably benign
PIT4519001:Sin3a UTSW 9 57095456 missense possibly damaging 0.86
R0024:Sin3a UTSW 9 57118253 intron probably benign
R0309:Sin3a UTSW 9 57110912 missense probably benign 0.00
R0511:Sin3a UTSW 9 57096895 nonsense probably null
R1205:Sin3a UTSW 9 57119175 missense probably damaging 1.00
R1365:Sin3a UTSW 9 57125203 nonsense probably null
R1496:Sin3a UTSW 9 57119158 missense possibly damaging 0.77
R1544:Sin3a UTSW 9 57103997 splice site probably benign
R1958:Sin3a UTSW 9 57105609 missense probably damaging 1.00
R1993:Sin3a UTSW 9 57101199 missense probably damaging 1.00
R2037:Sin3a UTSW 9 57096825 missense probably benign 0.14
R2065:Sin3a UTSW 9 57110800 missense possibly damaging 0.93
R2079:Sin3a UTSW 9 57089523 missense probably benign
R2193:Sin3a UTSW 9 57117477 missense possibly damaging 0.93
R3004:Sin3a UTSW 9 57096834 nonsense probably null
R3929:Sin3a UTSW 9 57118137 missense probably damaging 0.98
R4326:Sin3a UTSW 9 57095358 missense probably damaging 1.00
R4327:Sin3a UTSW 9 57095358 missense probably damaging 1.00
R4329:Sin3a UTSW 9 57095358 missense probably damaging 1.00
R4765:Sin3a UTSW 9 57096803 missense probably benign 0.14
R4806:Sin3a UTSW 9 57086742 missense probably damaging 0.99
R4979:Sin3a UTSW 9 57118076 missense probably damaging 1.00
R5018:Sin3a UTSW 9 57110891 missense probably benign 0.00
R5368:Sin3a UTSW 9 57110800 missense possibly damaging 0.93
R5379:Sin3a UTSW 9 57110988 missense probably benign 0.10
R5391:Sin3a UTSW 9 57105673 missense probably damaging 1.00
R5395:Sin3a UTSW 9 57105673 missense probably damaging 1.00
R5519:Sin3a UTSW 9 57118173 critical splice donor site probably null
R5927:Sin3a UTSW 9 57111111 missense probably damaging 1.00
R5987:Sin3a UTSW 9 57127200 missense possibly damaging 0.75
R6083:Sin3a UTSW 9 57107540 missense probably damaging 1.00
R6161:Sin3a UTSW 9 57095424 missense possibly damaging 0.48
R6196:Sin3a UTSW 9 57103929 missense probably damaging 1.00
R6374:Sin3a UTSW 9 57117481 missense probably benign
R6456:Sin3a UTSW 9 57113701 missense possibly damaging 0.79
R6815:Sin3a UTSW 9 57117540 missense probably benign 0.02
R6900:Sin3a UTSW 9 57107574 missense probably damaging 1.00
R7051:Sin3a UTSW 9 57103934 missense probably damaging 1.00
R7081:Sin3a UTSW 9 57094471 missense probably null 1.00
R7462:Sin3a UTSW 9 57095525 missense probably benign 0.00
R7538:Sin3a UTSW 9 57103926 missense possibly damaging 0.95
R7699:Sin3a UTSW 9 57110654 nonsense probably null
R8150:Sin3a UTSW 9 57127284 missense possibly damaging 0.92
R8158:Sin3a UTSW 9 57113544 critical splice acceptor site probably null
RF017:Sin3a UTSW 9 57127326 missense possibly damaging 0.90
X0026:Sin3a UTSW 9 57125192 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- CAGAATGACTGGTGTACAAATAAAGT -3'
(R):5'- TTGCACTGGTGGCTTGAAAG -3'

Sequencing Primer
(F):5'- CAGGTGGCATATGTCTAATCCCAG -3'
(R):5'- GCTTGAAAGGCATCTTCCTTG -3'
Posted On2019-06-26