Incidental Mutation 'R7285:Enpp1'
ID 565944
Institutional Source Beutler Lab
Gene Symbol Enpp1
Ensembl Gene ENSMUSG00000037370
Gene Name ectonucleotide pyrophosphatase/phosphodiesterase 1
Synonyms PC-1, E-NPP1, Npps, Pca, Pdnp1, CD203c, twy, NPP1, 4833416E15Rik, Pca-1, Ly-41
MMRRC Submission 045393-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.229) question?
Stock # R7285 (G1)
Quality Score 225.009
Status Validated
Chromosome 10
Chromosomal Location 24513812-24588057 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 24536059 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Isoleucine at position 447 (T447I)
Ref Sequence ENSEMBL: ENSMUSP00000114273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039882] [ENSMUST00000105520] [ENSMUST00000135846]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000039882
SMART Domains Protein: ENSMUSP00000046090
Gene: ENSMUSG00000037370

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
low complexity region 59 69 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 358 1e-44 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105520
AA Change: T447I

PolyPhen 2 Score 0.421 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000101159
Gene: ENSMUSG00000037370
AA Change: T447I

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 520 1.8e-87 PFAM
Endonuclease_NS 655 873 5.33e-15 SMART
NUC 656 887 3.62e-107 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135846
AA Change: T447I

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000114273
Gene: ENSMUSG00000037370
AA Change: T447I

DomainStartEndE-ValueType
low complexity region 22 34 N/A INTRINSIC
transmembrane domain 57 79 N/A INTRINSIC
SO 86 126 2.17e-14 SMART
SO 127 170 1.51e-13 SMART
Pfam:Phosphodiest 194 520 4.2e-91 PFAM
Endonuclease_NS 656 874 5.33e-15 SMART
NUC 657 888 3.62e-107 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: This gene encodes a member of the nucleoside pyrophosphatase/phosphodiesterase family of enzymes that catalyzes the hydrolysis of pyrophosphate and phosphodiester bonds in nucleotide triphosphates and oligonucleotides, respectively, to generate nucleoside 5'-monophosphates. The encoded protein is a type II transmembrane glycoprotein that negatively regulates bone mineralization. Mice harboring a nonsense mutation in this gene, termed tiptoe walking (ttw), exhibit ectopic ossification of the spinal ligaments. The encoded protein binds to the insulin receptor, inhibits downstream signaling events and induces insulin resistance and glucose tolerance. This gene is located adjacent to a paralog on chromosome 10. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Apr 2015]
PHENOTYPE: Mice homozygous for a null allele develop hyperostosis leading to ossific intervertebral fusion, peripheral joint ankylosis and tendon calcification, and display spontaneous arterial and articular cartilage calcification, and altered adipocyte maturation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca12 A T 1: 71,388,314 (GRCm39) C185* probably null Het
Abcc3 C T 11: 94,247,873 (GRCm39) A1207T probably benign Het
Adam1b T G 5: 121,639,056 (GRCm39) D663A probably damaging Het
Arhgap12 A T 18: 6,111,920 (GRCm39) L148Q probably damaging Het
Cdh4 A T 2: 179,439,258 (GRCm39) Q135L probably benign Het
Clca3b T C 3: 144,543,519 (GRCm39) I437V probably benign Het
Cldn15 A T 5: 137,001,327 (GRCm39) H124L probably benign Het
Cyp4a30b T C 4: 115,313,848 (GRCm39) M143T probably damaging Het
Dgcr2 A T 16: 17,662,944 (GRCm39) C353* probably null Het
Dhcr24 T A 4: 106,428,716 (GRCm39) probably null Het
Dock1 T G 7: 134,346,737 (GRCm39) L223R probably benign Het
Ece1 T A 4: 137,641,074 (GRCm39) probably null Het
Efcab5 A G 11: 77,028,170 (GRCm39) V387A probably benign Het
Efcab5 A G 11: 77,029,041 (GRCm39) F97L possibly damaging Het
Eme2 A T 17: 25,113,543 (GRCm39) probably null Het
Fam222b T C 11: 78,034,007 (GRCm39) S17P probably benign Het
Fbln1 A G 15: 85,121,829 (GRCm39) I317V probably benign Het
Fn1 T C 1: 71,676,498 (GRCm39) K578E probably damaging Het
Fscb A T 12: 64,518,323 (GRCm39) S1048T unknown Het
Fsd1l T A 4: 53,682,200 (GRCm39) probably null Het
Hexa T A 9: 59,471,222 (GRCm39) I492K probably benign Het
Inpp5e G A 2: 26,287,870 (GRCm39) A642V probably benign Het
Ints11 C T 4: 155,970,568 (GRCm39) A241V probably damaging Het
Irs2 A G 8: 11,056,797 (GRCm39) L545P probably damaging Het
Katnal2 G A 18: 77,081,271 (GRCm39) A409V probably benign Het
Kif13a C T 13: 46,905,931 (GRCm39) V671M possibly damaging Het
Lbx2 A G 6: 83,064,877 (GRCm39) K138R probably damaging Het
Lcor A G 19: 41,572,754 (GRCm39) K503R possibly damaging Het
Lpp G A 16: 24,796,029 (GRCm39) A558T probably damaging Het
Lypla1 T C 1: 4,911,321 (GRCm39) I202T probably benign Het
Magi3 G A 3: 103,941,430 (GRCm39) P842S probably benign Het
Meioc G A 11: 102,557,168 (GRCm39) V25M probably benign Het
Mthfr C T 4: 148,138,056 (GRCm39) T557I probably benign Het
Nbeal1 G C 1: 60,276,310 (GRCm39) V684L probably benign Het
Or2t44 T A 11: 58,677,310 (GRCm39) Y83* probably null Het
Or5d20-ps1 A T 2: 87,932,049 (GRCm39) I94N probably damaging Het
Osbpl10 A T 9: 115,052,771 (GRCm39) I440F probably damaging Het
Otx2 G A 14: 48,898,922 (GRCm39) A36V probably benign Het
Parg A G 14: 31,932,465 (GRCm39) Y435C probably damaging Het
Parvb A T 15: 84,166,985 (GRCm39) D100V possibly damaging Het
Prss27 A G 17: 24,264,665 (GRCm39) H276R probably benign Het
Prune1 T A 3: 95,162,357 (GRCm39) S439C probably damaging Het
Pudp C G 18: 50,701,287 (GRCm39) E149Q possibly damaging Het
Qng1 T C 13: 58,532,199 (GRCm39) Y119C probably damaging Het
Sin3a C A 9: 57,034,583 (GRCm39) T1252N possibly damaging Het
Sptbn2 A G 19: 4,787,471 (GRCm39) D927G probably benign Het
Stx18 C T 5: 38,262,251 (GRCm39) T89I possibly damaging Het
Ticrr T C 7: 79,310,610 (GRCm39) S175P possibly damaging Het
Tinag T C 9: 76,952,943 (GRCm39) T14A probably benign Het
Tmco3 G A 8: 13,369,605 (GRCm39) probably null Het
Trpm1 G T 7: 63,859,729 (GRCm39) E396* probably null Het
Txndc11 A G 16: 10,902,163 (GRCm39) Y684H probably damaging Het
Usp47 G A 7: 111,692,315 (GRCm39) E926K probably benign Het
Vmn1r233 A G 17: 21,214,221 (GRCm39) I243T probably damaging Het
Ythdf3 T A 3: 16,258,049 (GRCm39) probably null Het
Zfp12 A G 5: 143,230,444 (GRCm39) K289R probably damaging Het
Zfp950 T A 19: 61,107,550 (GRCm39) H511L probably benign Het
Other mutations in Enpp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Enpp1 APN 10 24,521,325 (GRCm39) missense possibly damaging 0.93
IGL00966:Enpp1 APN 10 24,529,929 (GRCm39) missense probably damaging 1.00
IGL01364:Enpp1 APN 10 24,540,512 (GRCm39) missense probably damaging 1.00
IGL02040:Enpp1 APN 10 24,531,754 (GRCm39) missense probably damaging 1.00
IGL02143:Enpp1 APN 10 24,553,872 (GRCm39) missense probably damaging 1.00
IGL02631:Enpp1 APN 10 24,517,859 (GRCm39) missense probably damaging 1.00
IGL02655:Enpp1 APN 10 24,553,872 (GRCm39) missense probably damaging 1.00
IGL02677:Enpp1 APN 10 24,555,083 (GRCm39) splice site probably benign
IGL02691:Enpp1 APN 10 24,587,790 (GRCm39) missense probably damaging 0.99
IGL02966:Enpp1 APN 10 24,536,172 (GRCm39) missense probably damaging 1.00
IGL03087:Enpp1 APN 10 24,531,779 (GRCm39) splice site probably benign
IGL03330:Enpp1 APN 10 24,540,804 (GRCm39) splice site probably benign
IGL03365:Enpp1 APN 10 24,544,923 (GRCm39) missense probably damaging 1.00
IGL03377:Enpp1 APN 10 24,536,181 (GRCm39) critical splice acceptor site probably null
PIT4651001:Enpp1 UTSW 10 24,529,848 (GRCm39) missense probably benign 0.16
R0011:Enpp1 UTSW 10 24,545,900 (GRCm39) nonsense probably null
R0201:Enpp1 UTSW 10 24,529,815 (GRCm39) missense probably benign 0.00
R0496:Enpp1 UTSW 10 24,547,950 (GRCm39) missense probably benign 0.18
R1228:Enpp1 UTSW 10 24,521,310 (GRCm39) missense probably benign 0.30
R1536:Enpp1 UTSW 10 24,517,732 (GRCm39) missense probably benign 0.27
R1927:Enpp1 UTSW 10 24,530,786 (GRCm39) missense possibly damaging 0.65
R2051:Enpp1 UTSW 10 24,587,702 (GRCm39) critical splice donor site probably null
R2057:Enpp1 UTSW 10 24,536,090 (GRCm39) missense probably damaging 0.98
R2353:Enpp1 UTSW 10 24,527,239 (GRCm39) missense probably benign 0.24
R4077:Enpp1 UTSW 10 24,544,905 (GRCm39) critical splice donor site probably null
R4079:Enpp1 UTSW 10 24,544,905 (GRCm39) critical splice donor site probably null
R4739:Enpp1 UTSW 10 24,555,146 (GRCm39) missense probably null 0.99
R4740:Enpp1 UTSW 10 24,555,146 (GRCm39) missense probably null 0.99
R4761:Enpp1 UTSW 10 24,517,849 (GRCm39) missense possibly damaging 0.94
R4822:Enpp1 UTSW 10 24,537,833 (GRCm39) missense possibly damaging 0.74
R4919:Enpp1 UTSW 10 24,523,983 (GRCm39) missense probably benign 0.01
R5140:Enpp1 UTSW 10 24,528,750 (GRCm39) missense possibly damaging 0.51
R5302:Enpp1 UTSW 10 24,527,288 (GRCm39) missense probably benign
R5421:Enpp1 UTSW 10 24,545,655 (GRCm39) missense probably damaging 1.00
R5695:Enpp1 UTSW 10 24,530,806 (GRCm39) missense probably damaging 0.99
R5735:Enpp1 UTSW 10 24,530,817 (GRCm39) missense possibly damaging 0.92
R5789:Enpp1 UTSW 10 24,523,137 (GRCm39) missense probably benign
R5942:Enpp1 UTSW 10 24,551,966 (GRCm39) nonsense probably null
R6048:Enpp1 UTSW 10 24,536,152 (GRCm39) missense probably damaging 1.00
R6053:Enpp1 UTSW 10 24,533,024 (GRCm39) missense possibly damaging 0.93
R6305:Enpp1 UTSW 10 24,517,780 (GRCm39) missense probably damaging 1.00
R6319:Enpp1 UTSW 10 24,523,929 (GRCm39) missense probably damaging 1.00
R6624:Enpp1 UTSW 10 24,545,653 (GRCm39) nonsense probably null
R6793:Enpp1 UTSW 10 24,531,723 (GRCm39) missense probably damaging 1.00
R6936:Enpp1 UTSW 10 24,527,237 (GRCm39) missense probably benign 0.30
R7255:Enpp1 UTSW 10 24,521,213 (GRCm39) missense possibly damaging 0.95
R7401:Enpp1 UTSW 10 24,521,180 (GRCm39) missense probably damaging 1.00
R7429:Enpp1 UTSW 10 24,587,848 (GRCm39) missense probably benign 0.00
R7430:Enpp1 UTSW 10 24,587,848 (GRCm39) missense probably benign 0.00
R7526:Enpp1 UTSW 10 24,550,308 (GRCm39) splice site probably null
R7532:Enpp1 UTSW 10 24,551,885 (GRCm39) missense probably benign 0.29
R7789:Enpp1 UTSW 10 24,529,981 (GRCm39) splice site probably null
R8073:Enpp1 UTSW 10 24,555,142 (GRCm39) missense possibly damaging 0.50
R8283:Enpp1 UTSW 10 24,550,554 (GRCm39) missense probably benign 0.25
R8955:Enpp1 UTSW 10 24,544,926 (GRCm39) missense probably benign 0.01
R9494:Enpp1 UTSW 10 24,527,234 (GRCm39) missense probably benign
Z1177:Enpp1 UTSW 10 24,537,840 (GRCm39) missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TACCACATAGTGTCCGGTCC -3'
(R):5'- CGTTGTGTCTTATCAGATGATCAAC -3'

Sequencing Primer
(F):5'- GTGTCCGGTCCAAAAATCTAATAGG -3'
(R):5'- GCAGATCTCTGTGAGCTCAAG -3'
Posted On 2019-06-26