Incidental Mutation 'R7285:Fscb'
ID565951
Institutional Source Beutler Lab
Gene Symbol Fscb
Ensembl Gene ENSMUSG00000043060
Gene Namefibrous sheath CABYR binding protein
SynonymsEG623046
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R7285 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location64471330-64474690 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 64471549 bp
ZygosityHeterozygous
Amino Acid Change Serine to Threonine at position 1048 (S1048T)
Ref Sequence ENSEMBL: ENSMUSP00000051554 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059833]
Predicted Effect unknown
Transcript: ENSMUST00000059833
AA Change: S1048T
SMART Domains Protein: ENSMUSP00000051554
Gene: ENSMUSG00000043060
AA Change: S1048T

DomainStartEndE-ValueType
low complexity region 2 10 N/A INTRINSIC
low complexity region 273 290 N/A INTRINSIC
internal_repeat_1 295 465 2.4e-7 PROSPERO
low complexity region 483 501 N/A INTRINSIC
low complexity region 510 547 N/A INTRINSIC
low complexity region 558 595 N/A INTRINSIC
low complexity region 599 622 N/A INTRINSIC
low complexity region 641 661 N/A INTRINSIC
low complexity region 673 708 N/A INTRINSIC
low complexity region 721 730 N/A INTRINSIC
internal_repeat_1 736 895 2.4e-7 PROSPERO
internal_repeat_2 751 871 6.17e-6 PROSPERO
low complexity region 899 916 N/A INTRINSIC
internal_repeat_2 919 1046 6.17e-6 PROSPERO
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T C 13: 58,384,385 Y119C probably damaging Het
Abca12 A T 1: 71,349,155 C185* probably null Het
Abcc3 C T 11: 94,357,047 A1207T probably benign Het
Adam1b T G 5: 121,500,993 D663A probably damaging Het
Arhgap12 A T 18: 6,111,920 L148Q probably damaging Het
Cdh4 A T 2: 179,797,465 Q135L probably benign Het
Clca3b T C 3: 144,837,758 I437V probably benign Het
Cldn15 A T 5: 136,972,473 H124L probably benign Het
Cyp4a30b T C 4: 115,456,651 M143T probably damaging Het
Dgcr2 A T 16: 17,845,080 C353* probably null Het
Dhcr24 T A 4: 106,571,519 probably null Het
Dock1 T G 7: 134,745,008 L223R probably benign Het
Ece1 T A 4: 137,913,763 probably null Het
Efcab5 A G 11: 77,137,344 V387A probably benign Het
Efcab5 A G 11: 77,138,215 F97L possibly damaging Het
Eme2 A T 17: 24,894,569 probably null Het
Enpp1 G A 10: 24,660,161 T447I probably benign Het
Fam222b T C 11: 78,143,181 S17P probably benign Het
Fbln1 A G 15: 85,237,628 I317V probably benign Het
Fn1 T C 1: 71,637,339 K578E probably damaging Het
Fsd1l T A 4: 53,682,200 probably null Het
Gm340 A G 19: 41,584,315 K503R possibly damaging Het
Hexa T A 9: 59,563,939 I492K probably benign Het
Inpp5e G A 2: 26,397,858 A642V probably benign Het
Ints11 C T 4: 155,886,111 A241V probably damaging Het
Irs2 A G 8: 11,006,797 L545P probably damaging Het
Katnal2 G A 18: 76,993,575 A409V probably benign Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Lbx2 A G 6: 83,087,896 K138R probably damaging Het
Lpp G A 16: 24,977,279 A558T probably damaging Het
Lypla1 T C 1: 4,841,098 I202T probably benign Het
Magi3 G A 3: 104,034,114 P842S probably benign Het
Meioc G A 11: 102,666,342 V25M probably benign Het
Mthfr C T 4: 148,053,599 T557I probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Olfr1165-ps A T 2: 88,101,705 I94N probably damaging Het
Olfr314 T A 11: 58,786,484 Y83* probably null Het
Osbpl10 A T 9: 115,223,703 I440F probably damaging Het
Otx2 G A 14: 48,661,465 A36V probably benign Het
Parg A G 14: 32,210,508 Y435C probably damaging Het
Parvb A T 15: 84,282,784 D100V possibly damaging Het
Prss27 A G 17: 24,045,691 H276R probably benign Het
Prune1 T A 3: 95,255,046 S439C probably damaging Het
Pudp C G 18: 50,568,216 E149Q possibly damaging Het
Sin3a C A 9: 57,127,299 T1252N possibly damaging Het
Sptbn2 A G 19: 4,737,443 D927G probably benign Het
Stx18 C T 5: 38,104,907 T89I possibly damaging Het
Ticrr T C 7: 79,660,862 S175P possibly damaging Het
Tinag T C 9: 77,045,661 T14A probably benign Het
Tmco3 G A 8: 13,319,605 probably null Het
Trpm1 G T 7: 64,209,981 E396* probably null Het
Txndc11 A G 16: 11,084,299 Y684H probably damaging Het
Usp47 G A 7: 112,093,108 E926K probably benign Het
Vmn1r233 A G 17: 20,993,959 I243T probably damaging Het
Ythdf3 T A 3: 16,203,885 probably null Het
Zfp12 A G 5: 143,244,689 K289R probably damaging Het
Zfp950 T A 19: 61,119,112 H511L probably benign Het
Other mutations in Fscb
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01095:Fscb APN 12 64473381 missense possibly damaging 0.46
IGL01099:Fscb APN 12 64472101 missense unknown
IGL01394:Fscb APN 12 64473804 missense possibly damaging 0.83
IGL02570:Fscb APN 12 64472178 missense unknown
IGL02974:Fscb APN 12 64471525 missense unknown
IGL03150:Fscb APN 12 64472430 missense unknown
IGL03407:Fscb APN 12 64473495 missense probably damaging 0.96
BB007:Fscb UTSW 12 64472563 missense unknown
BB017:Fscb UTSW 12 64472563 missense unknown
FR4548:Fscb UTSW 12 64472563 missense unknown
FR4548:Fscb UTSW 12 64472565 missense unknown
R0056:Fscb UTSW 12 64474247 missense possibly damaging 0.66
R0490:Fscb UTSW 12 64472887 missense unknown
R0492:Fscb UTSW 12 64473518 missense possibly damaging 0.46
R0702:Fscb UTSW 12 64472001 missense unknown
R1017:Fscb UTSW 12 64473468 missense probably benign 0.07
R1672:Fscb UTSW 12 64471518 missense unknown
R1737:Fscb UTSW 12 64474581 missense possibly damaging 0.83
R1795:Fscb UTSW 12 64474401 missense probably damaging 0.99
R1969:Fscb UTSW 12 64473234 missense unknown
R1984:Fscb UTSW 12 64474683 missense unknown
R2164:Fscb UTSW 12 64473793 missense probably damaging 0.96
R2213:Fscb UTSW 12 64474116 missense possibly damaging 0.84
R2874:Fscb UTSW 12 64473436 missense probably benign 0.00
R2878:Fscb UTSW 12 64472574 missense unknown
R3873:Fscb UTSW 12 64473132 missense unknown
R4734:Fscb UTSW 12 64474470 missense possibly damaging 0.82
R4773:Fscb UTSW 12 64473690 missense probably damaging 1.00
R4940:Fscb UTSW 12 64473814 missense probably benign 0.03
R4981:Fscb UTSW 12 64473619 missense possibly damaging 0.46
R5105:Fscb UTSW 12 64473336 missense possibly damaging 0.82
R5845:Fscb UTSW 12 64472784 missense unknown
R6049:Fscb UTSW 12 64474320 missense possibly damaging 0.66
R6743:Fscb UTSW 12 64471573 missense unknown
R7026:Fscb UTSW 12 64471617 missense unknown
R7372:Fscb UTSW 12 64471824 missense unknown
R7400:Fscb UTSW 12 64471617 missense unknown
R7563:Fscb UTSW 12 64473285 missense possibly damaging 0.82
R7748:Fscb UTSW 12 64474407 missense probably benign 0.04
R7759:Fscb UTSW 12 64474092 missense probably benign 0.03
R7930:Fscb UTSW 12 64472563 missense unknown
R8026:Fscb UTSW 12 64474275 missense probably benign 0.12
R8070:Fscb UTSW 12 64474608 missense probably benign 0.04
R8081:Fscb UTSW 12 64472028 missense unknown
R8331:Fscb UTSW 12 64473468 missense probably benign 0.07
RF011:Fscb UTSW 12 64472994 small deletion probably benign
RF019:Fscb UTSW 12 64472596 small insertion probably benign
RF038:Fscb UTSW 12 64472569 small insertion probably benign
Z1176:Fscb UTSW 12 64472930 missense unknown
Z1177:Fscb UTSW 12 64472628 missense unknown
Predicted Primers PCR Primer
(F):5'- GTCCAACCTGTATGCTTAATCG -3'
(R):5'- TCGTGTGGAAAAGATGCCTG -3'

Sequencing Primer
(F):5'- AACCTGTATGCTTAATCGTTTTAGGG -3'
(R):5'- GATGCCTGCTGAAGATCCAC -3'
Posted On2019-06-26