Incidental Mutation 'R7285:Parg'
ID565954
Institutional Source Beutler Lab
Gene Symbol Parg
Ensembl Gene ENSMUSG00000021911
Gene Namepoly (ADP-ribose) glycohydrolase
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7285 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location32201949-32297550 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32210508 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 435 (Y435C)
Ref Sequence ENSEMBL: ENSMUSP00000022470 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022470] [ENSMUST00000163350] [ENSMUST00000164137] [ENSMUST00000167699] [ENSMUST00000170129] [ENSMUST00000170840] [ENSMUST00000171279]
Predicted Effect probably damaging
Transcript: ENSMUST00000022470
AA Change: Y435C

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000022470
Gene: ENSMUSG00000021911
AA Change: Y435C

DomainStartEndE-ValueType
low complexity region 190 204 N/A INTRINSIC
low complexity region 286 298 N/A INTRINSIC
Pfam:PARG_cat 574 902 2.5e-135 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000163350
AA Change: Y435C

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000131566
Gene: ENSMUSG00000021911
AA Change: Y435C

DomainStartEndE-ValueType
low complexity region 190 204 N/A INTRINSIC
low complexity region 286 298 N/A INTRINSIC
Pfam:PARG_cat 570 905 5.1e-134 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000164137
AA Change: Y435C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably benign
Transcript: ENSMUST00000167699
Predicted Effect probably benign
Transcript: ENSMUST00000170129
Predicted Effect probably benign
Transcript: ENSMUST00000170840
SMART Domains Protein: ENSMUSP00000132454
Gene: ENSMUSG00000021911

DomainStartEndE-ValueType
Pfam:PARG_cat 117 452 9.7e-135 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171279
SMART Domains Protein: ENSMUSP00000128629
Gene: ENSMUSG00000021911

DomainStartEndE-ValueType
low complexity region 107 121 N/A INTRINSIC
Meta Mutation Damage Score 0.1001 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Poly(ADP-ribose) glycohydrolase (PARG) is the major enzyme responsible for the catabolism of poly(ADP-ribose), a reversible covalent-modifier of chromosomal proteins. The protein is found in many tissues and may be subject to proteolysis generating smaller, active products. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for one allele of this gene are hypersensitive to alkylating agents and ionizing radiation and susceptible to streptozotocin induced diabetes and endotoxic shock. Mice homozygous for a second allele display embryonic lethality and fail tohatch from the zona pellucida. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T C 13: 58,384,385 Y119C probably damaging Het
Abca12 A T 1: 71,349,155 C185* probably null Het
Abcc3 C T 11: 94,357,047 A1207T probably benign Het
Adam1b T G 5: 121,500,993 D663A probably damaging Het
Arhgap12 A T 18: 6,111,920 L148Q probably damaging Het
Cdh4 A T 2: 179,797,465 Q135L probably benign Het
Clca3b T C 3: 144,837,758 I437V probably benign Het
Cldn15 A T 5: 136,972,473 H124L probably benign Het
Cyp4a30b T C 4: 115,456,651 M143T probably damaging Het
Dgcr2 A T 16: 17,845,080 C353* probably null Het
Dhcr24 T A 4: 106,571,519 probably null Het
Dock1 T G 7: 134,745,008 L223R probably benign Het
Ece1 T A 4: 137,913,763 probably null Het
Efcab5 A G 11: 77,137,344 V387A probably benign Het
Efcab5 A G 11: 77,138,215 F97L possibly damaging Het
Eme2 A T 17: 24,894,569 probably null Het
Enpp1 G A 10: 24,660,161 T447I probably benign Het
Fam222b T C 11: 78,143,181 S17P probably benign Het
Fbln1 A G 15: 85,237,628 I317V probably benign Het
Fn1 T C 1: 71,637,339 K578E probably damaging Het
Fscb A T 12: 64,471,549 S1048T unknown Het
Fsd1l T A 4: 53,682,200 probably null Het
Gm340 A G 19: 41,584,315 K503R possibly damaging Het
Hexa T A 9: 59,563,939 I492K probably benign Het
Inpp5e G A 2: 26,397,858 A642V probably benign Het
Ints11 C T 4: 155,886,111 A241V probably damaging Het
Irs2 A G 8: 11,006,797 L545P probably damaging Het
Katnal2 G A 18: 76,993,575 A409V probably benign Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Lbx2 A G 6: 83,087,896 K138R probably damaging Het
Lpp G A 16: 24,977,279 A558T probably damaging Het
Lypla1 T C 1: 4,841,098 I202T probably benign Het
Magi3 G A 3: 104,034,114 P842S probably benign Het
Meioc G A 11: 102,666,342 V25M probably benign Het
Mthfr C T 4: 148,053,599 T557I probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Olfr1165-ps A T 2: 88,101,705 I94N probably damaging Het
Olfr314 T A 11: 58,786,484 Y83* probably null Het
Osbpl10 A T 9: 115,223,703 I440F probably damaging Het
Otx2 G A 14: 48,661,465 A36V probably benign Het
Parvb A T 15: 84,282,784 D100V possibly damaging Het
Prss27 A G 17: 24,045,691 H276R probably benign Het
Prune1 T A 3: 95,255,046 S439C probably damaging Het
Pudp C G 18: 50,568,216 E149Q possibly damaging Het
Sin3a C A 9: 57,127,299 T1252N possibly damaging Het
Sptbn2 A G 19: 4,737,443 D927G probably benign Het
Stx18 C T 5: 38,104,907 T89I possibly damaging Het
Ticrr T C 7: 79,660,862 S175P possibly damaging Het
Tinag T C 9: 77,045,661 T14A probably benign Het
Tmco3 G A 8: 13,319,605 probably null Het
Trpm1 G T 7: 64,209,981 E396* probably null Het
Txndc11 A G 16: 11,084,299 Y684H probably damaging Het
Usp47 G A 7: 112,093,108 E926K probably benign Het
Vmn1r233 A G 17: 20,993,959 I243T probably damaging Het
Ythdf3 T A 3: 16,203,885 probably null Het
Zfp12 A G 5: 143,244,689 K289R probably damaging Het
Zfp950 T A 19: 61,119,112 H511L probably benign Het
Other mutations in Parg
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01324:Parg APN 14 32296185 splice site probably benign
IGL01879:Parg APN 14 32271622 splice site probably benign
IGL02391:Parg APN 14 32262681 splice site probably null
IGL02451:Parg APN 14 32242229 missense probably damaging 1.00
IGL02598:Parg APN 14 32214324 missense probably damaging 1.00
IGL02899:Parg APN 14 32238574 missense probably damaging 1.00
R0112:Parg UTSW 14 32202433 missense probably damaging 1.00
R0167:Parg UTSW 14 32217736 critical splice donor site probably null
R0514:Parg UTSW 14 32254560 missense possibly damaging 0.69
R0834:Parg UTSW 14 32214554 splice site probably benign
R1140:Parg UTSW 14 32296243 missense probably benign 0.01
R1480:Parg UTSW 14 32209628 nonsense probably null
R1611:Parg UTSW 14 32238570 missense probably damaging 1.00
R1912:Parg UTSW 14 32210540 missense probably damaging 0.99
R1916:Parg UTSW 14 32208227 splice site probably benign
R1983:Parg UTSW 14 32217696 missense probably damaging 1.00
R2007:Parg UTSW 14 32210574 missense possibly damaging 0.87
R2275:Parg UTSW 14 32295238 missense probably damaging 0.98
R2942:Parg UTSW 14 32209337 missense probably damaging 1.00
R4206:Parg UTSW 14 32254536 missense probably benign 0.07
R4482:Parg UTSW 14 32262774 missense probably damaging 1.00
R4512:Parg UTSW 14 32262736 missense probably damaging 1.00
R4519:Parg UTSW 14 32209635 missense probably damaging 1.00
R4611:Parg UTSW 14 32274864 missense probably damaging 1.00
R4831:Parg UTSW 14 32202451 missense probably benign 0.00
R4876:Parg UTSW 14 32271668 missense probably damaging 0.98
R5298:Parg UTSW 14 32202253 missense probably damaging 1.00
R5606:Parg UTSW 14 32262736 missense probably damaging 1.00
R5782:Parg UTSW 14 32274905 nonsense probably null
R5878:Parg UTSW 14 32217662 missense possibly damaging 0.85
R6373:Parg UTSW 14 32209497 splice site probably null
R6436:Parg UTSW 14 32271677 missense probably damaging 1.00
R6530:Parg UTSW 14 32209199 missense probably damaging 1.00
R7348:Parg UTSW 14 32250079 missense possibly damaging 0.82
R7455:Parg UTSW 14 32209475 missense probably benign
R7780:Parg UTSW 14 32208801 missense possibly damaging 0.94
R7887:Parg UTSW 14 32217662 missense possibly damaging 0.85
R7968:Parg UTSW 14 32214370 missense possibly damaging 0.57
R8153:Parg UTSW 14 32262820 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTATAAAGCAAGTTTGGCACAC -3'
(R):5'- TGCTCTGAAGGATCTAATAAGAGAGC -3'

Sequencing Primer
(F):5'- TGGCACACAAAGGCAGTAATATTC -3'
(R):5'- GGATCTAATAAGAGAGCAAACATGG -3'
Posted On2019-06-26