Incidental Mutation 'R7285:Otx2'
ID565955
Institutional Source Beutler Lab
Gene Symbol Otx2
Ensembl Gene ENSMUSG00000021848
Gene Nameorthodenticle homeobox 2
SynonymsE130306E05Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7285 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location48657677-48673819 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 48661465 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 36 (A36V)
Ref Sequence ENSEMBL: ENSMUSP00000112532 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000118578] [ENSMUST00000119070] [ENSMUST00000119739] [ENSMUST00000122009] [ENSMUST00000133479] [ENSMUST00000144465] [ENSMUST00000152018] [ENSMUST00000226501] [ENSMUST00000227404]
Predicted Effect probably benign
Transcript: ENSMUST00000118578
SMART Domains Protein: ENSMUSP00000113690
Gene: ENSMUSG00000021848

DomainStartEndE-ValueType
HOX 38 100 9.7e-25 SMART
low complexity region 132 151 N/A INTRINSIC
Pfam:TF_Otx 153 235 4.5e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119070
AA Change: A36V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000112532
Gene: ENSMUSG00000021848
AA Change: A36V

DomainStartEndE-ValueType
HOX 46 108 9.7e-25 SMART
low complexity region 140 159 N/A INTRINSIC
Pfam:TF_Otx 161 242 1.6e-35 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000119739
Predicted Effect probably benign
Transcript: ENSMUST00000122009
SMART Domains Protein: ENSMUSP00000113930
Gene: ENSMUSG00000021848

DomainStartEndE-ValueType
HOX 38 100 9.7e-25 SMART
low complexity region 132 151 N/A INTRINSIC
Pfam:TF_Otx 153 235 4.5e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000133479
SMART Domains Protein: ENSMUSP00000122200
Gene: ENSMUSG00000021848

DomainStartEndE-ValueType
Pfam:Homeobox 39 63 1.3e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000144465
AA Change: A36V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000116630
Gene: ENSMUSG00000021848
AA Change: A36V

DomainStartEndE-ValueType
HOX 46 98 3.83e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152018
SMART Domains Protein: ENSMUSP00000123454
Gene: ENSMUSG00000021848

DomainStartEndE-ValueType
HOX 38 100 9.7e-25 SMART
low complexity region 132 151 N/A INTRINSIC
Pfam:TF_Otx 153 207 3.5e-27 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000226501
Predicted Effect probably benign
Transcript: ENSMUST00000227404
Meta Mutation Damage Score 0.0688 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: This gene encodes a protein that belongs to the homeobox family of transcription factors. The encoded protein plays a role in the development and patterning of the head. This protein regulates development of the choroid plexuses in the brain affecting composition of cerebrospinal fluid in the developing brain and is thought to function in the development of sense organs in the embryo. In humans, mutations in this gene are associated with pituitary hormone deficiency. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Nov 2013]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality during organogenesis due to abnormal gastrulation and embryonic patterning in the brain and heart. Mice heterozygous for another knock-out allele exhibit female-specific lethality, reduced male fertility and abnoral gonadotrophs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T C 13: 58,384,385 Y119C probably damaging Het
Abca12 A T 1: 71,349,155 C185* probably null Het
Abcc3 C T 11: 94,357,047 A1207T probably benign Het
Adam1b T G 5: 121,500,993 D663A probably damaging Het
Arhgap12 A T 18: 6,111,920 L148Q probably damaging Het
Cdh4 A T 2: 179,797,465 Q135L probably benign Het
Clca3b T C 3: 144,837,758 I437V probably benign Het
Cldn15 A T 5: 136,972,473 H124L probably benign Het
Cyp4a30b T C 4: 115,456,651 M143T probably damaging Het
Dgcr2 A T 16: 17,845,080 C353* probably null Het
Dhcr24 T A 4: 106,571,519 probably null Het
Dock1 T G 7: 134,745,008 L223R probably benign Het
Ece1 T A 4: 137,913,763 probably null Het
Efcab5 A G 11: 77,137,344 V387A probably benign Het
Efcab5 A G 11: 77,138,215 F97L possibly damaging Het
Eme2 A T 17: 24,894,569 probably null Het
Enpp1 G A 10: 24,660,161 T447I probably benign Het
Fam222b T C 11: 78,143,181 S17P probably benign Het
Fbln1 A G 15: 85,237,628 I317V probably benign Het
Fn1 T C 1: 71,637,339 K578E probably damaging Het
Fscb A T 12: 64,471,549 S1048T unknown Het
Fsd1l T A 4: 53,682,200 probably null Het
Gm340 A G 19: 41,584,315 K503R possibly damaging Het
Hexa T A 9: 59,563,939 I492K probably benign Het
Inpp5e G A 2: 26,397,858 A642V probably benign Het
Ints11 C T 4: 155,886,111 A241V probably damaging Het
Irs2 A G 8: 11,006,797 L545P probably damaging Het
Katnal2 G A 18: 76,993,575 A409V probably benign Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Lbx2 A G 6: 83,087,896 K138R probably damaging Het
Lpp G A 16: 24,977,279 A558T probably damaging Het
Lypla1 T C 1: 4,841,098 I202T probably benign Het
Magi3 G A 3: 104,034,114 P842S probably benign Het
Meioc G A 11: 102,666,342 V25M probably benign Het
Mthfr C T 4: 148,053,599 T557I probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Olfr1165-ps A T 2: 88,101,705 I94N probably damaging Het
Olfr314 T A 11: 58,786,484 Y83* probably null Het
Osbpl10 A T 9: 115,223,703 I440F probably damaging Het
Parg A G 14: 32,210,508 Y435C probably damaging Het
Parvb A T 15: 84,282,784 D100V possibly damaging Het
Prss27 A G 17: 24,045,691 H276R probably benign Het
Prune1 T A 3: 95,255,046 S439C probably damaging Het
Pudp C G 18: 50,568,216 E149Q possibly damaging Het
Sin3a C A 9: 57,127,299 T1252N possibly damaging Het
Sptbn2 A G 19: 4,737,443 D927G probably benign Het
Stx18 C T 5: 38,104,907 T89I possibly damaging Het
Ticrr T C 7: 79,660,862 S175P possibly damaging Het
Tinag T C 9: 77,045,661 T14A probably benign Het
Tmco3 G A 8: 13,319,605 probably null Het
Trpm1 G T 7: 64,209,981 E396* probably null Het
Txndc11 A G 16: 11,084,299 Y684H probably damaging Het
Usp47 G A 7: 112,093,108 E926K probably benign Het
Vmn1r233 A G 17: 20,993,959 I243T probably damaging Het
Ythdf3 T A 3: 16,203,885 probably null Het
Zfp12 A G 5: 143,244,689 K289R probably damaging Het
Zfp950 T A 19: 61,119,112 H511L probably benign Het
Other mutations in Otx2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00510:Otx2 APN 14 48658735 missense probably benign 0.00
IGL02194:Otx2 APN 14 48661393 missense possibly damaging 0.95
IGL03214:Otx2 APN 14 48661324 missense probably damaging 1.00
IGL03393:Otx2 APN 14 48661324 missense probably damaging 1.00
R1022:Otx2 UTSW 14 48659272 small deletion probably benign
R3430:Otx2 UTSW 14 48658797 missense probably damaging 1.00
R4118:Otx2 UTSW 14 48659154 missense probably benign 0.01
R6058:Otx2 UTSW 14 48658758 missense probably damaging 1.00
R7009:Otx2 UTSW 14 48658797 missense probably damaging 1.00
R7090:Otx2 UTSW 14 48658735 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- CAAGGCCTCATTGGGTCATCAG -3'
(R):5'- AAGTAATTTGTAGCTGGCGTCG -3'

Sequencing Primer
(F):5'- GCCTCATTGGGTCATCAGTATAAACC -3'
(R):5'- ATTACACTGGGAGGTCGT -3'
Posted On2019-06-26