Incidental Mutation 'R7285:Dgcr2'
ID565959
Institutional Source Beutler Lab
Gene Symbol Dgcr2
Ensembl Gene ENSMUSG00000003166
Gene NameDiGeorge syndrome critical region gene 2
Synonyms9930034O06Rik, Dgsc, Dgcr2, DGS-C, Lan, Sez12, Idd
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7285 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location17839482-17898562 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 17845080 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 353 (C353*)
Ref Sequence ENSEMBL: ENSMUSP00000012152 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000012152] [ENSMUST00000066127] [ENSMUST00000117082] [ENSMUST00000117945] [ENSMUST00000150068] [ENSMUST00000155943]
Predicted Effect probably null
Transcript: ENSMUST00000012152
AA Change: C353*
SMART Domains Protein: ENSMUSP00000012152
Gene: ENSMUSG00000003166
AA Change: C353*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LDLa 29 68 6.28e-11 SMART
CLECT 114 265 1.06e-14 SMART
VWC 270 331 1.42e-9 SMART
transmembrane domain 345 367 N/A INTRINSIC
low complexity region 369 377 N/A INTRINSIC
low complexity region 438 449 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000066127
AA Change: C282*
SMART Domains Protein: ENSMUSP00000064603
Gene: ENSMUSG00000003166
AA Change: C282*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LDLa 29 68 6.28e-11 SMART
CLECT 111 262 1.06e-14 SMART
transmembrane domain 274 296 N/A INTRINSIC
low complexity region 298 306 N/A INTRINSIC
low complexity region 367 378 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000117082
AA Change: C352*
SMART Domains Protein: ENSMUSP00000113506
Gene: ENSMUSG00000003166
AA Change: C352*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LDLa 29 68 5.86e-11 SMART
CLECT 113 264 1.06e-14 SMART
VWC 269 330 1.42e-9 SMART
transmembrane domain 344 366 N/A INTRINSIC
low complexity region 368 376 N/A INTRINSIC
low complexity region 437 448 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000117945
AA Change: C350*
SMART Domains Protein: ENSMUSP00000112783
Gene: ENSMUSG00000003166
AA Change: C350*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LDLa 29 68 6.28e-11 SMART
CLECT 111 262 1.06e-14 SMART
VWC 267 328 1.42e-9 SMART
transmembrane domain 342 364 N/A INTRINSIC
low complexity region 366 374 N/A INTRINSIC
low complexity region 435 446 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000150068
AA Change: C353*
SMART Domains Protein: ENSMUSP00000115071
Gene: ENSMUSG00000092470
AA Change: C353*

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
LDLa 29 68 6.28e-11 SMART
CLECT 114 265 1.06e-14 SMART
VWC 270 331 1.42e-9 SMART
transmembrane domain 345 367 N/A INTRINSIC
low complexity region 369 377 N/A INTRINSIC
low complexity region 438 449 N/A INTRINSIC
low complexity region 559 565 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000155943
AA Change: C130*
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Deletions of the 22q11.2 have been associated with a wide range of developmental defects (notably DiGeorge syndrome, velocardiofacial syndrome, conotruncal anomaly face syndrome and isolated conotruncal cardiac defects) classified under the acronym CATCH 22. The DGCR2 gene encodes a novel putative adhesion receptor protein, which could play a role in neural crest cells migration, a process which has been proposed to be altered in DiGeorge syndrome. Alternative splicing results in multiple transcript variants.[provided by RefSeq, May 2010]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T C 13: 58,384,385 Y119C probably damaging Het
Abca12 A T 1: 71,349,155 C185* probably null Het
Abcc3 C T 11: 94,357,047 A1207T probably benign Het
Adam1b T G 5: 121,500,993 D663A probably damaging Het
Arhgap12 A T 18: 6,111,920 L148Q probably damaging Het
Cdh4 A T 2: 179,797,465 Q135L probably benign Het
Clca3b T C 3: 144,837,758 I437V probably benign Het
Cldn15 A T 5: 136,972,473 H124L probably benign Het
Cyp4a30b T C 4: 115,456,651 M143T probably damaging Het
Dhcr24 T A 4: 106,571,519 probably null Het
Dock1 T G 7: 134,745,008 L223R probably benign Het
Ece1 T A 4: 137,913,763 probably null Het
Efcab5 A G 11: 77,137,344 V387A probably benign Het
Efcab5 A G 11: 77,138,215 F97L possibly damaging Het
Eme2 A T 17: 24,894,569 probably null Het
Enpp1 G A 10: 24,660,161 T447I probably benign Het
Fam222b T C 11: 78,143,181 S17P probably benign Het
Fbln1 A G 15: 85,237,628 I317V probably benign Het
Fn1 T C 1: 71,637,339 K578E probably damaging Het
Fscb A T 12: 64,471,549 S1048T unknown Het
Fsd1l T A 4: 53,682,200 probably null Het
Gm340 A G 19: 41,584,315 K503R possibly damaging Het
Hexa T A 9: 59,563,939 I492K probably benign Het
Inpp5e G A 2: 26,397,858 A642V probably benign Het
Ints11 C T 4: 155,886,111 A241V probably damaging Het
Irs2 A G 8: 11,006,797 L545P probably damaging Het
Katnal2 G A 18: 76,993,575 A409V probably benign Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Lbx2 A G 6: 83,087,896 K138R probably damaging Het
Lpp G A 16: 24,977,279 A558T probably damaging Het
Lypla1 T C 1: 4,841,098 I202T probably benign Het
Magi3 G A 3: 104,034,114 P842S probably benign Het
Meioc G A 11: 102,666,342 V25M probably benign Het
Mthfr C T 4: 148,053,599 T557I probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Olfr1165-ps A T 2: 88,101,705 I94N probably damaging Het
Olfr314 T A 11: 58,786,484 Y83* probably null Het
Osbpl10 A T 9: 115,223,703 I440F probably damaging Het
Otx2 G A 14: 48,661,465 A36V probably benign Het
Parg A G 14: 32,210,508 Y435C probably damaging Het
Parvb A T 15: 84,282,784 D100V possibly damaging Het
Prss27 A G 17: 24,045,691 H276R probably benign Het
Prune1 T A 3: 95,255,046 S439C probably damaging Het
Pudp C G 18: 50,568,216 E149Q possibly damaging Het
Sin3a C A 9: 57,127,299 T1252N possibly damaging Het
Sptbn2 A G 19: 4,737,443 D927G probably benign Het
Stx18 C T 5: 38,104,907 T89I possibly damaging Het
Ticrr T C 7: 79,660,862 S175P possibly damaging Het
Tinag T C 9: 77,045,661 T14A probably benign Het
Tmco3 G A 8: 13,319,605 probably null Het
Trpm1 G T 7: 64,209,981 E396* probably null Het
Txndc11 A G 16: 11,084,299 Y684H probably damaging Het
Usp47 G A 7: 112,093,108 E926K probably benign Het
Vmn1r233 A G 17: 20,993,959 I243T probably damaging Het
Ythdf3 T A 3: 16,203,885 probably null Het
Zfp12 A G 5: 143,244,689 K289R probably damaging Het
Zfp950 T A 19: 61,119,112 H511L probably benign Het
Other mutations in Dgcr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0135:Dgcr2 UTSW 16 17858442 missense probably damaging 0.99
R0218:Dgcr2 UTSW 16 17849786 missense probably damaging 1.00
R0627:Dgcr2 UTSW 16 17844008 missense probably damaging 1.00
R1450:Dgcr2 UTSW 16 17856814 missense possibly damaging 0.71
R1769:Dgcr2 UTSW 16 17857251 splice site probably benign
R1836:Dgcr2 UTSW 16 17849720 missense probably damaging 1.00
R2152:Dgcr2 UTSW 16 17891487 unclassified probably null
R2259:Dgcr2 UTSW 16 17844977 splice site probably null
R4815:Dgcr2 UTSW 16 17858619 intron probably benign
R4829:Dgcr2 UTSW 16 17842753 missense possibly damaging 0.90
R5372:Dgcr2 UTSW 16 17872644 missense probably benign 0.00
R5931:Dgcr2 UTSW 16 17857309 missense possibly damaging 0.71
R7008:Dgcr2 UTSW 16 17845001 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGTTCAGCCACAAGGAAAG -3'
(R):5'- GCATTGTAAAAGCACTGGGTG -3'

Sequencing Primer
(F):5'- TGTGGCTACTGAGGGACAC -3'
(R):5'- CATTGTAAAAGCACTGGGTGTAGGG -3'
Posted On2019-06-26