Incidental Mutation 'R0635:Lao1'
ID56596
Institutional Source Beutler Lab
Gene Symbol Lao1
Ensembl Gene ENSMUSG00000024903
Gene NameL-amino acid oxidase 1
Synonyms
MMRRC Submission 038824-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.067) question?
Stock #R0635 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location118961578-118968912 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 118968296 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 438 (R438C)
Ref Sequence ENSEMBL: ENSMUSP00000062834 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058651]
Predicted Effect probably benign
Transcript: ENSMUST00000058651
AA Change: R438C

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000062834
Gene: ENSMUSG00000024903
AA Change: R438C

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Pyr_redox_2 39 133 1.9e-8 PFAM
Pfam:HI0933_like 58 98 2.2e-7 PFAM
Pfam:FAD_binding_2 59 99 2.2e-7 PFAM
Pfam:Pyr_redox 59 106 5.4e-7 PFAM
Pfam:NAD_binding_8 62 129 8.1e-15 PFAM
Pfam:Amino_oxidase 67 509 3.1e-76 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142457
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145395
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 99% (68/69)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele show alterations in the free amino acid composition and antibacterial activity of milk and increased susceptibility to intramammary bacterial infection. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
3632451O06Rik A G 14: 49,773,143 L369S probably benign Het
4932429P05Rik T C X: 89,752,522 probably benign Het
5730455P16Rik A T 11: 80,374,065 probably benign Het
Adamts15 A G 9: 30,904,770 L631P probably damaging Het
Adamts17 T C 7: 66,908,605 F266L probably damaging Het
Adgrb1 C A 15: 74,540,892 Q488K possibly damaging Het
Cep290 A G 10: 100,492,676 D109G probably damaging Het
Chil5 A T 3: 106,017,203 Y229N possibly damaging Het
Cntnap1 A G 11: 101,183,459 T742A probably benign Het
Col6a3 A T 1: 90,808,086 probably null Het
Col6a5 G A 9: 105,928,606 P1034S unknown Het
Daxx T A 17: 33,912,644 D442E probably benign Het
Dmxl1 T C 18: 49,851,423 probably benign Het
Dnah11 A G 12: 118,007,996 F2942S probably damaging Het
Fam71a T C 1: 191,163,727 T240A probably benign Het
Glg1 A G 8: 111,163,764 probably benign Het
Gm10272 G A 10: 77,706,701 probably benign Het
Gm17333 AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA 16: 77,852,878 noncoding transcript Het
Haao A G 17: 83,838,574 F83S probably damaging Het
Hdgfl2 T A 17: 56,096,057 L177Q probably damaging Het
Hrh1 T C 6: 114,480,145 V129A probably damaging Het
Ift43 T A 12: 86,085,081 probably benign Het
Il21r T C 7: 125,632,506 Y369H probably damaging Het
Il2ra C T 2: 11,680,366 T171M probably benign Het
Lrrcc1 G A 3: 14,559,228 S350N probably benign Het
Mageb5 T A X: 91,779,993 Y260F probably benign Het
March5 A T 19: 37,220,408 I159F possibly damaging Het
Mgat4a G A 1: 37,452,294 A282V probably benign Het
Mipep G A 14: 60,829,390 V420I probably damaging Het
Morc2b A T 17: 33,137,687 F370L possibly damaging Het
Mt1 A T 8: 94,179,821 probably null Het
Ncapd2 A G 6: 125,173,036 V943A probably benign Het
Nkd2 T C 13: 73,826,894 D58G probably benign Het
Nol8 C G 13: 49,676,758 S1106C probably benign Het
Nrm C A 17: 35,864,264 Y61* probably null Het
Nusap1 A G 2: 119,627,667 T95A probably damaging Het
Ocln T A 13: 100,506,236 Q197L probably damaging Het
Olfr495 T A 7: 108,395,764 F215I probably benign Het
Oxtr A G 6: 112,489,200 Y200H probably damaging Het
Paip2b T C 6: 83,809,909 E115G possibly damaging Het
Pcm1 T A 8: 41,267,179 probably benign Het
Pcnt T C 10: 76,404,585 D1205G probably damaging Het
Phka1 G A X: 102,621,400 R186C probably damaging Het
Pik3cb A G 9: 99,064,218 probably benign Het
Pik3r1 C T 13: 101,757,418 R81K probably benign Het
Ppa1 A G 10: 61,665,440 D162G probably benign Het
Ppa1 A G 10: 61,666,970 R191G probably damaging Het
Prss22 T A 17: 23,996,688 T87S probably benign Het
Rgr T A 14: 37,038,947 R218* probably null Het
Rreb1 A T 13: 37,941,564 Q1282L possibly damaging Het
Scel T A 14: 103,583,139 probably null Het
Sema6b A G 17: 56,129,971 probably null Het
Slc4a1 T C 11: 102,352,672 E711G possibly damaging Het
Snx19 C A 9: 30,428,810 L415M probably damaging Het
Snx19 T G 9: 30,428,811 L415R probably damaging Het
Specc1 G A 11: 62,118,903 R495Q probably damaging Het
Tead1 T C 7: 112,891,706 probably benign Het
Timm10b A C 7: 105,640,688 probably benign Het
Ubxn7 T A 16: 32,367,417 probably benign Het
Vmn2r116 T A 17: 23,386,887 Y258N possibly damaging Het
Vmn2r77 T A 7: 86,811,175 F570I probably benign Het
Vmn2r98 T C 17: 19,080,497 V587A probably benign Het
Zfp398 T C 6: 47,863,140 I101T probably damaging Het
Zfp808 T A 13: 62,172,419 H487Q probably damaging Het
Other mutations in Lao1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02105:Lao1 APN 4 118968443 missense probably damaging 0.97
IGL02252:Lao1 APN 4 118967416 missense probably benign 0.19
R0139:Lao1 UTSW 4 118964202 missense probably benign 0.06
R0541:Lao1 UTSW 4 118963802 missense probably benign 0.03
R1164:Lao1 UTSW 4 118965405 missense probably benign 0.00
R4465:Lao1 UTSW 4 118965307 missense probably benign 0.10
R4767:Lao1 UTSW 4 118967988 missense probably damaging 1.00
R4950:Lao1 UTSW 4 118965375 missense probably damaging 1.00
R5061:Lao1 UTSW 4 118967476 missense probably benign 0.00
R5488:Lao1 UTSW 4 118967369 missense probably damaging 1.00
R5644:Lao1 UTSW 4 118965236 splice site probably null
R6176:Lao1 UTSW 4 118962000 start codon destroyed probably null 0.40
R6189:Lao1 UTSW 4 118967880 missense probably benign 0.00
R6857:Lao1 UTSW 4 118963826 critical splice donor site probably null
R6859:Lao1 UTSW 4 118963751 missense probably damaging 0.99
R7074:Lao1 UTSW 4 118968185 missense probably damaging 1.00
R7878:Lao1 UTSW 4 118967422 missense probably benign 0.00
R8021:Lao1 UTSW 4 118968477 missense probably damaging 0.99
X0021:Lao1 UTSW 4 118968522 missense probably benign 0.00
Z1176:Lao1 UTSW 4 118968440 missense probably damaging 1.00
Z1177:Lao1 UTSW 4 118968371 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTTCATTACACCAGTGCCACCAAG -3'
(R):5'- ATGCTCCCCAGCAAAGTAGATGC -3'

Sequencing Primer
(F):5'- TAGTGTGCAACGAACGCTTC -3'
(R):5'- AAAGTAGATGCGGCCCTCTG -3'
Posted On2013-07-11