Incidental Mutation 'R7285:Prss27'
ID565962
Institutional Source Beutler Lab
Gene Symbol Prss27
Ensembl Gene ENSMUSG00000050762
Gene Nameprotease, serine 27
SynonymsMpn, marapsin, Pancreasin, CAPH2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7285 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location24038144-24045954 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 24045691 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 276 (H276R)
Ref Sequence ENSEMBL: ENSMUSP00000056483 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000017090] [ENSMUST00000059482]
Predicted Effect probably benign
Transcript: ENSMUST00000017090
SMART Domains Protein: ENSMUSP00000017090
Gene: ENSMUSG00000016946

DomainStartEndE-ValueType
low complexity region 8 31 N/A INTRINSIC
BTB 44 146 2.76e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000059482
AA Change: H276R

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000056483
Gene: ENSMUSG00000050762
AA Change: H276R

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Tryp_SPc 37 275 2.29e-92 SMART
low complexity region 283 301 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is located within a large protease gene cluster on chromosome 16. It belongs to the group-1 subfamily of serine proteases. The encoded protein is a secreted tryptic serine protease and is expressed mainly in the pancreas. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2016]
PHENOTYPE: Mice homozygous for a gene trap allele develop normally and are fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T C 13: 58,384,385 Y119C probably damaging Het
Abca12 A T 1: 71,349,155 C185* probably null Het
Abcc3 C T 11: 94,357,047 A1207T probably benign Het
Adam1b T G 5: 121,500,993 D663A probably damaging Het
Arhgap12 A T 18: 6,111,920 L148Q probably damaging Het
Cdh4 A T 2: 179,797,465 Q135L probably benign Het
Clca3b T C 3: 144,837,758 I437V probably benign Het
Cldn15 A T 5: 136,972,473 H124L probably benign Het
Cyp4a30b T C 4: 115,456,651 M143T probably damaging Het
Dgcr2 A T 16: 17,845,080 C353* probably null Het
Dhcr24 T A 4: 106,571,519 probably null Het
Dock1 T G 7: 134,745,008 L223R probably benign Het
Ece1 T A 4: 137,913,763 probably null Het
Efcab5 A G 11: 77,137,344 V387A probably benign Het
Efcab5 A G 11: 77,138,215 F97L possibly damaging Het
Eme2 A T 17: 24,894,569 probably null Het
Enpp1 G A 10: 24,660,161 T447I probably benign Het
Fam222b T C 11: 78,143,181 S17P probably benign Het
Fbln1 A G 15: 85,237,628 I317V probably benign Het
Fn1 T C 1: 71,637,339 K578E probably damaging Het
Fscb A T 12: 64,471,549 S1048T unknown Het
Fsd1l T A 4: 53,682,200 probably null Het
Gm340 A G 19: 41,584,315 K503R possibly damaging Het
Hexa T A 9: 59,563,939 I492K probably benign Het
Inpp5e G A 2: 26,397,858 A642V probably benign Het
Ints11 C T 4: 155,886,111 A241V probably damaging Het
Irs2 A G 8: 11,006,797 L545P probably damaging Het
Katnal2 G A 18: 76,993,575 A409V probably benign Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Lbx2 A G 6: 83,087,896 K138R probably damaging Het
Lpp G A 16: 24,977,279 A558T probably damaging Het
Lypla1 T C 1: 4,841,098 I202T probably benign Het
Magi3 G A 3: 104,034,114 P842S probably benign Het
Meioc G A 11: 102,666,342 V25M probably benign Het
Mthfr C T 4: 148,053,599 T557I probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Olfr1165-ps A T 2: 88,101,705 I94N probably damaging Het
Olfr314 T A 11: 58,786,484 Y83* probably null Het
Osbpl10 A T 9: 115,223,703 I440F probably damaging Het
Otx2 G A 14: 48,661,465 A36V probably benign Het
Parg A G 14: 32,210,508 Y435C probably damaging Het
Parvb A T 15: 84,282,784 D100V possibly damaging Het
Prune1 T A 3: 95,255,046 S439C probably damaging Het
Pudp C G 18: 50,568,216 E149Q possibly damaging Het
Sin3a C A 9: 57,127,299 T1252N possibly damaging Het
Sptbn2 A G 19: 4,737,443 D927G probably benign Het
Stx18 C T 5: 38,104,907 T89I possibly damaging Het
Ticrr T C 7: 79,660,862 S175P possibly damaging Het
Tinag T C 9: 77,045,661 T14A probably benign Het
Tmco3 G A 8: 13,319,605 probably null Het
Trpm1 G T 7: 64,209,981 E396* probably null Het
Txndc11 A G 16: 11,084,299 Y684H probably damaging Het
Usp47 G A 7: 112,093,108 E926K probably benign Het
Vmn1r233 A G 17: 20,993,959 I243T probably damaging Het
Ythdf3 T A 3: 16,203,885 probably null Het
Zfp12 A G 5: 143,244,689 K289R probably damaging Het
Zfp950 T A 19: 61,119,112 H511L probably benign Het
Other mutations in Prss27
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01574:Prss27 APN 17 24038371 splice site probably benign
IGL01633:Prss27 APN 17 24045676 missense probably damaging 1.00
IGL02096:Prss27 APN 17 24044977 missense possibly damaging 0.94
IGL02318:Prss27 APN 17 24045597 missense probably benign 0.01
IGL02491:Prss27 APN 17 24044255 splice site probably benign
IGL02715:Prss27 APN 17 24044979 missense possibly damaging 0.94
R1582:Prss27 UTSW 17 24044903 missense probably benign 0.11
R5078:Prss27 UTSW 17 24044440 nonsense probably null
R5468:Prss27 UTSW 17 24038313 missense possibly damaging 0.53
R6415:Prss27 UTSW 17 24042908 nonsense probably null
R6450:Prss27 UTSW 17 24045014 nonsense probably null
R6477:Prss27 UTSW 17 24044261 missense probably damaging 1.00
R7143:Prss27 UTSW 17 24045658 missense probably damaging 1.00
R7447:Prss27 UTSW 17 24045709 missense probably damaging 1.00
R7825:Prss27 UTSW 17 24042958 missense probably damaging 1.00
R8240:Prss27 UTSW 17 24044945 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- AGGATCTTTGTGAGGCCAGG -3'
(R):5'- ATTTACAAATGTACAGTGGGTGGGG -3'

Sequencing Primer
(F):5'- CCAGGGTAGGTTCTGATGGCAC -3'
(R):5'- CCACCTGTGGGGCTGGG -3'
Posted On2019-06-26