Incidental Mutation 'R7285:Katnal2'
ID565967
Institutional Source Beutler Lab
Gene Symbol Katnal2
Ensembl Gene ENSMUSG00000025420
Gene Namekatanin p60 subunit A-like 2
Synonyms4933439B08Rik, 3110023G01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7285 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location76977148-77047308 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 76993575 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 409 (A409V)
Ref Sequence ENSEMBL: ENSMUSP00000026486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026486] [ENSMUST00000122984] [ENSMUST00000126153] [ENSMUST00000135029] [ENSMUST00000137354] [ENSMUST00000137498]
Predicted Effect probably benign
Transcript: ENSMUST00000026486
AA Change: A409V

PolyPhen 2 Score 0.197 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000026486
Gene: ENSMUSG00000025420
AA Change: A409V

DomainStartEndE-ValueType
LisH 25 57 8.53e-6 SMART
AAA 287 400 6.46e-11 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122984
Predicted Effect probably benign
Transcript: ENSMUST00000126153
SMART Domains Protein: ENSMUSP00000122079
Gene: ENSMUSG00000025420

DomainStartEndE-ValueType
LisH 25 57 8.53e-6 SMART
AAA 287 425 1.74e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000135029
SMART Domains Protein: ENSMUSP00000115411
Gene: ENSMUSG00000025420

DomainStartEndE-ValueType
LisH 25 57 8.53e-6 SMART
AAA 287 372 2.95e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137354
SMART Domains Protein: ENSMUSP00000118511
Gene: ENSMUSG00000025420

DomainStartEndE-ValueType
AAA 25 163 1.74e-16 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000137498
SMART Domains Protein: ENSMUSP00000117495
Gene: ENSMUSG00000025420

DomainStartEndE-ValueType
AAA 243 381 1.74e-16 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T C 13: 58,384,385 Y119C probably damaging Het
Abca12 A T 1: 71,349,155 C185* probably null Het
Abcc3 C T 11: 94,357,047 A1207T probably benign Het
Adam1b T G 5: 121,500,993 D663A probably damaging Het
Arhgap12 A T 18: 6,111,920 L148Q probably damaging Het
Cdh4 A T 2: 179,797,465 Q135L probably benign Het
Clca3b T C 3: 144,837,758 I437V probably benign Het
Cldn15 A T 5: 136,972,473 H124L probably benign Het
Cyp4a30b T C 4: 115,456,651 M143T probably damaging Het
Dgcr2 A T 16: 17,845,080 C353* probably null Het
Dhcr24 T A 4: 106,571,519 probably null Het
Dock1 T G 7: 134,745,008 L223R probably benign Het
Ece1 T A 4: 137,913,763 probably null Het
Efcab5 A G 11: 77,137,344 V387A probably benign Het
Efcab5 A G 11: 77,138,215 F97L possibly damaging Het
Eme2 A T 17: 24,894,569 probably null Het
Enpp1 G A 10: 24,660,161 T447I probably benign Het
Fam222b T C 11: 78,143,181 S17P probably benign Het
Fbln1 A G 15: 85,237,628 I317V probably benign Het
Fn1 T C 1: 71,637,339 K578E probably damaging Het
Fscb A T 12: 64,471,549 S1048T unknown Het
Fsd1l T A 4: 53,682,200 probably null Het
Gm340 A G 19: 41,584,315 K503R possibly damaging Het
Hexa T A 9: 59,563,939 I492K probably benign Het
Inpp5e G A 2: 26,397,858 A642V probably benign Het
Ints11 C T 4: 155,886,111 A241V probably damaging Het
Irs2 A G 8: 11,006,797 L545P probably damaging Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Lbx2 A G 6: 83,087,896 K138R probably damaging Het
Lpp G A 16: 24,977,279 A558T probably damaging Het
Lypla1 T C 1: 4,841,098 I202T probably benign Het
Magi3 G A 3: 104,034,114 P842S probably benign Het
Meioc G A 11: 102,666,342 V25M probably benign Het
Mthfr C T 4: 148,053,599 T557I probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Olfr1165-ps A T 2: 88,101,705 I94N probably damaging Het
Olfr314 T A 11: 58,786,484 Y83* probably null Het
Osbpl10 A T 9: 115,223,703 I440F probably damaging Het
Otx2 G A 14: 48,661,465 A36V probably benign Het
Parg A G 14: 32,210,508 Y435C probably damaging Het
Parvb A T 15: 84,282,784 D100V possibly damaging Het
Prss27 A G 17: 24,045,691 H276R probably benign Het
Prune1 T A 3: 95,255,046 S439C probably damaging Het
Pudp C G 18: 50,568,216 E149Q possibly damaging Het
Sin3a C A 9: 57,127,299 T1252N possibly damaging Het
Sptbn2 A G 19: 4,737,443 D927G probably benign Het
Stx18 C T 5: 38,104,907 T89I possibly damaging Het
Ticrr T C 7: 79,660,862 S175P possibly damaging Het
Tinag T C 9: 77,045,661 T14A probably benign Het
Tmco3 G A 8: 13,319,605 probably null Het
Trpm1 G T 7: 64,209,981 E396* probably null Het
Txndc11 A G 16: 11,084,299 Y684H probably damaging Het
Usp47 G A 7: 112,093,108 E926K probably benign Het
Vmn1r233 A G 17: 20,993,959 I243T probably damaging Het
Ythdf3 T A 3: 16,203,885 probably null Het
Zfp12 A G 5: 143,244,689 K289R probably damaging Het
Zfp950 T A 19: 61,119,112 H511L probably benign Het
Other mutations in Katnal2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00886:Katnal2 APN 18 77002754 missense probably damaging 1.00
IGL00976:Katnal2 APN 18 77017493 missense probably damaging 1.00
IGL01012:Katnal2 APN 18 77017554 missense probably damaging 0.96
IGL01302:Katnal2 APN 18 77047167 splice site probably benign
IGL01377:Katnal2 APN 18 77002457 missense probably damaging 1.00
IGL01532:Katnal2 APN 18 77012000 missense probably benign
IGL03203:Katnal2 APN 18 77007524 missense probably damaging 1.00
R0592:Katnal2 UTSW 18 77002560 splice site probably null
R1348:Katnal2 UTSW 18 76978542 splice site probably null
R1419:Katnal2 UTSW 18 76977432 missense possibly damaging 0.85
R1755:Katnal2 UTSW 18 77012067 missense probably benign 0.01
R1772:Katnal2 UTSW 18 77002537 missense probably damaging 1.00
R1852:Katnal2 UTSW 18 77016023 missense probably benign 0.08
R1952:Katnal2 UTSW 18 76980011 missense probably benign 0.00
R2115:Katnal2 UTSW 18 76980091 missense probably damaging 1.00
R2155:Katnal2 UTSW 18 77010941 missense probably benign 0.01
R4765:Katnal2 UTSW 18 76977543 splice site probably null
R5126:Katnal2 UTSW 18 77017598 missense probably benign 0.13
R5141:Katnal2 UTSW 18 76997641 missense probably damaging 1.00
R5315:Katnal2 UTSW 18 77012009 missense probably benign 0.02
R5358:Katnal2 UTSW 18 77017494 missense possibly damaging 0.47
R5412:Katnal2 UTSW 18 77002435 missense probably damaging 1.00
R6289:Katnal2 UTSW 18 77017455 splice site probably null
R6647:Katnal2 UTSW 18 76980037 missense probably benign 0.01
R6919:Katnal2 UTSW 18 77011038 missense probably benign 0.05
R7039:Katnal2 UTSW 18 77047172 critical splice donor site probably null
Z1176:Katnal2 UTSW 18 77012057 missense probably benign
Predicted Primers PCR Primer
(F):5'- GTGGGCCCAGGTCTAGATTATG -3'
(R):5'- TATCCCAGAGTGGTTTAGGAACAATTC -3'

Sequencing Primer
(F):5'- GAACTGCCTAAAATTTGTCTCGGTC -3'
(R):5'- GAGTGGTTTAGGAACAATTCTAGAAG -3'
Posted On2019-06-26