Incidental Mutation 'R7285:Sptbn2'
ID565968
Institutional Source Beutler Lab
Gene Symbol Sptbn2
Ensembl Gene ENSMUSG00000067889
Gene Namespectrin beta, non-erythrocytic 2
SynonymsSpnb3
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7285 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location4711208-4752353 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4737443 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 927 (D927G)
Ref Sequence ENSEMBL: ENSMUSP00000008991 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000008991]
Predicted Effect probably benign
Transcript: ENSMUST00000008991
AA Change: D927G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000008991
Gene: ENSMUSG00000067889
AA Change: D927G

DomainStartEndE-ValueType
CH 59 159 1.86e-28 SMART
CH 178 276 2.86e-20 SMART
SPEC 308 414 4.63e-1 SMART
SPEC 428 528 3.07e-23 SMART
SPEC 534 638 4.47e-25 SMART
SPEC 644 744 1.28e-25 SMART
SPEC 750 849 4.98e-23 SMART
SPEC 855 955 1.63e-18 SMART
SPEC 961 1062 1.45e-24 SMART
SPEC 1068 1169 4.15e-20 SMART
SPEC 1175 1275 5.26e-22 SMART
SPEC 1281 1380 1.17e-19 SMART
SPEC 1386 1485 2.06e-24 SMART
SPEC 1491 1585 1.74e-22 SMART
SPEC 1591 1691 5.42e-24 SMART
SPEC 1697 1798 2.1e-21 SMART
SPEC 1804 1904 5.47e-20 SMART
SPEC 1910 2010 1.99e-22 SMART
SPEC 2016 2256 2.92e-6 SMART
PH 2219 2330 1.65e-14 SMART
low complexity region 2373 2386 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Spectrins are principle components of a cell's membrane-cytoskeleton and are composed of two alpha and two beta spectrin subunits. The protein encoded by this gene (SPTBN2), is called spectrin beta non-erythrocytic 2 or beta-III spectrin. It is related to, but distinct from, the beta-II spectrin gene which is also known as spectrin beta non-erythrocytic 1 (SPTBN1). SPTBN2 regulates the glutamate signaling pathway by stabilizing the glutamate transporter EAAT4 at the surface of the plasma membrane. Mutations in this gene cause a form of spinocerebellar ataxia, SCA5, that is characterized by neurodegeneration, progressive locomotor incoordination, dysarthria, and uncoordinated eye movements. [provided by RefSeq, Dec 2009]
PHENOTYPE: Homozygous hypomorphic mutants exhibit a progressive ataxic phenotype with gait abnormalities, tremor, deteriorating motor coordination, Purkinje cell loss, and cerebellar atrophy (molecular layer thinning) and age-related reduction in simple firing ratein surviving Purkinje cells. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T C 13: 58,384,385 Y119C probably damaging Het
Abca12 A T 1: 71,349,155 C185* probably null Het
Abcc3 C T 11: 94,357,047 A1207T probably benign Het
Adam1b T G 5: 121,500,993 D663A probably damaging Het
Arhgap12 A T 18: 6,111,920 L148Q probably damaging Het
Cdh4 A T 2: 179,797,465 Q135L probably benign Het
Clca3b T C 3: 144,837,758 I437V probably benign Het
Cldn15 A T 5: 136,972,473 H124L probably benign Het
Cyp4a30b T C 4: 115,456,651 M143T probably damaging Het
Dgcr2 A T 16: 17,845,080 C353* probably null Het
Dhcr24 T A 4: 106,571,519 probably null Het
Dock1 T G 7: 134,745,008 L223R probably benign Het
Ece1 T A 4: 137,913,763 probably null Het
Efcab5 A G 11: 77,137,344 V387A probably benign Het
Efcab5 A G 11: 77,138,215 F97L possibly damaging Het
Eme2 A T 17: 24,894,569 probably null Het
Enpp1 G A 10: 24,660,161 T447I probably benign Het
Fam222b T C 11: 78,143,181 S17P probably benign Het
Fbln1 A G 15: 85,237,628 I317V probably benign Het
Fn1 T C 1: 71,637,339 K578E probably damaging Het
Fscb A T 12: 64,471,549 S1048T unknown Het
Fsd1l T A 4: 53,682,200 probably null Het
Gm340 A G 19: 41,584,315 K503R possibly damaging Het
Hexa T A 9: 59,563,939 I492K probably benign Het
Inpp5e G A 2: 26,397,858 A642V probably benign Het
Ints11 C T 4: 155,886,111 A241V probably damaging Het
Irs2 A G 8: 11,006,797 L545P probably damaging Het
Katnal2 G A 18: 76,993,575 A409V probably benign Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Lbx2 A G 6: 83,087,896 K138R probably damaging Het
Lpp G A 16: 24,977,279 A558T probably damaging Het
Lypla1 T C 1: 4,841,098 I202T probably benign Het
Magi3 G A 3: 104,034,114 P842S probably benign Het
Meioc G A 11: 102,666,342 V25M probably benign Het
Mthfr C T 4: 148,053,599 T557I probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Olfr1165-ps A T 2: 88,101,705 I94N probably damaging Het
Olfr314 T A 11: 58,786,484 Y83* probably null Het
Osbpl10 A T 9: 115,223,703 I440F probably damaging Het
Otx2 G A 14: 48,661,465 A36V probably benign Het
Parg A G 14: 32,210,508 Y435C probably damaging Het
Parvb A T 15: 84,282,784 D100V possibly damaging Het
Prss27 A G 17: 24,045,691 H276R probably benign Het
Prune1 T A 3: 95,255,046 S439C probably damaging Het
Pudp C G 18: 50,568,216 E149Q possibly damaging Het
Sin3a C A 9: 57,127,299 T1252N possibly damaging Het
Stx18 C T 5: 38,104,907 T89I possibly damaging Het
Ticrr T C 7: 79,660,862 S175P possibly damaging Het
Tinag T C 9: 77,045,661 T14A probably benign Het
Tmco3 G A 8: 13,319,605 probably null Het
Trpm1 G T 7: 64,209,981 E396* probably null Het
Txndc11 A G 16: 11,084,299 Y684H probably damaging Het
Usp47 G A 7: 112,093,108 E926K probably benign Het
Vmn1r233 A G 17: 20,993,959 I243T probably damaging Het
Ythdf3 T A 3: 16,203,885 probably null Het
Zfp12 A G 5: 143,244,689 K289R probably damaging Het
Zfp950 T A 19: 61,119,112 H511L probably benign Het
Other mutations in Sptbn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Sptbn2 APN 19 4724705 missense possibly damaging 0.94
IGL00688:Sptbn2 APN 19 4725938 missense probably damaging 1.00
IGL01339:Sptbn2 APN 19 4745972 nonsense probably null
IGL01373:Sptbn2 APN 19 4745972 nonsense probably null
IGL01420:Sptbn2 APN 19 4734125 missense probably benign
IGL01456:Sptbn2 APN 19 4746749 missense probably damaging 1.00
IGL01953:Sptbn2 APN 19 4749693 missense probably benign
IGL03026:Sptbn2 APN 19 4724233 critical splice donor site probably null
IGL03275:Sptbn2 APN 19 4732661 missense possibly damaging 0.65
IGL03286:Sptbn2 APN 19 4747832 missense probably damaging 0.97
F5770:Sptbn2 UTSW 19 4750632 missense probably damaging 1.00
PIT4696001:Sptbn2 UTSW 19 4745577 missense probably benign 0.00
R0046:Sptbn2 UTSW 19 4745377 intron probably benign
R0046:Sptbn2 UTSW 19 4745377 intron probably benign
R0121:Sptbn2 UTSW 19 4745293 missense probably damaging 1.00
R0127:Sptbn2 UTSW 19 4724744 missense probably damaging 1.00
R0212:Sptbn2 UTSW 19 4746942 critical splice donor site probably null
R0277:Sptbn2 UTSW 19 4745145 missense probably benign 0.28
R0417:Sptbn2 UTSW 19 4737926 missense probably benign 0.01
R0457:Sptbn2 UTSW 19 4745938 missense possibly damaging 0.89
R0536:Sptbn2 UTSW 19 4726690 missense probably damaging 0.99
R0631:Sptbn2 UTSW 19 4739986 missense probably benign 0.01
R0734:Sptbn2 UTSW 19 4748123 nonsense probably null
R0742:Sptbn2 UTSW 19 4718983 missense possibly damaging 0.46
R1195:Sptbn2 UTSW 19 4745893 missense possibly damaging 0.85
R1195:Sptbn2 UTSW 19 4745893 missense possibly damaging 0.85
R1195:Sptbn2 UTSW 19 4745893 missense possibly damaging 0.85
R1364:Sptbn2 UTSW 19 4732665 missense probably damaging 1.00
R1495:Sptbn2 UTSW 19 4718976 missense possibly damaging 0.92
R1498:Sptbn2 UTSW 19 4744246 missense possibly damaging 0.94
R1606:Sptbn2 UTSW 19 4750242 critical splice donor site probably null
R1678:Sptbn2 UTSW 19 4750497 missense probably damaging 1.00
R1746:Sptbn2 UTSW 19 4745964 nonsense probably null
R1820:Sptbn2 UTSW 19 4726596 missense probably damaging 0.98
R1830:Sptbn2 UTSW 19 4732541 missense probably benign 0.09
R1863:Sptbn2 UTSW 19 4732685 missense possibly damaging 0.54
R1967:Sptbn2 UTSW 19 4745299 missense probably benign 0.00
R2085:Sptbn2 UTSW 19 4738559 missense probably benign 0.09
R2301:Sptbn2 UTSW 19 4734138 missense probably benign 0.00
R2310:Sptbn2 UTSW 19 4718935 missense probably benign 0.19
R2888:Sptbn2 UTSW 19 4748636 missense possibly damaging 0.52
R3788:Sptbn2 UTSW 19 4745922 missense probably damaging 1.00
R4429:Sptbn2 UTSW 19 4738355 missense probably damaging 1.00
R4536:Sptbn2 UTSW 19 4732602 missense probably damaging 1.00
R4662:Sptbn2 UTSW 19 4739239 missense probably damaging 1.00
R4672:Sptbn2 UTSW 19 4732496 missense probably benign 0.25
R4731:Sptbn2 UTSW 19 4742480 missense probably damaging 0.96
R4747:Sptbn2 UTSW 19 4748154 missense probably benign 0.27
R4889:Sptbn2 UTSW 19 4729430 missense possibly damaging 0.69
R4891:Sptbn2 UTSW 19 4738469 missense probably damaging 1.00
R4965:Sptbn2 UTSW 19 4729309 missense probably benign 0.13
R4968:Sptbn2 UTSW 19 4729202 intron probably null
R4981:Sptbn2 UTSW 19 4751658 missense probably benign 0.22
R5159:Sptbn2 UTSW 19 4737857 missense probably benign 0.12
R5202:Sptbn2 UTSW 19 4724184 missense probably damaging 1.00
R5253:Sptbn2 UTSW 19 4750082 missense probably benign 0.01
R5294:Sptbn2 UTSW 19 4718908 missense possibly damaging 0.67
R5465:Sptbn2 UTSW 19 4750105 missense probably benign 0.00
R5546:Sptbn2 UTSW 19 4725950 missense probably damaging 1.00
R5593:Sptbn2 UTSW 19 4748947 missense probably damaging 1.00
R5780:Sptbn2 UTSW 19 4724667 missense probably damaging 1.00
R5835:Sptbn2 UTSW 19 4738219 missense probably damaging 1.00
R6008:Sptbn2 UTSW 19 4739278 missense possibly damaging 0.89
R6108:Sptbn2 UTSW 19 4731392 critical splice donor site probably null
R6236:Sptbn2 UTSW 19 4748138 missense probably benign 0.01
R6307:Sptbn2 UTSW 19 4724646 missense probably damaging 1.00
R6383:Sptbn2 UTSW 19 4732496 missense possibly damaging 0.89
R6397:Sptbn2 UTSW 19 4742418 missense possibly damaging 0.91
R6453:Sptbn2 UTSW 19 4744180 missense possibly damaging 0.67
R6561:Sptbn2 UTSW 19 4747926 missense probably benign 0.39
R6564:Sptbn2 UTSW 19 4732024 missense probably damaging 1.00
R6644:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R6703:Sptbn2 UTSW 19 4749814 missense probably benign
R6703:Sptbn2 UTSW 19 4749815 missense probably benign
R6753:Sptbn2 UTSW 19 4747785 missense probably benign 0.01
R7007:Sptbn2 UTSW 19 4744145 missense possibly damaging 0.82
R7131:Sptbn2 UTSW 19 4749460 missense probably null
R7219:Sptbn2 UTSW 19 4724173 missense probably damaging 1.00
R7308:Sptbn2 UTSW 19 4751574 missense probably benign
R7469:Sptbn2 UTSW 19 4745118 missense probably benign 0.00
R7502:Sptbn2 UTSW 19 4748082 missense probably benign 0.02
R7623:Sptbn2 UTSW 19 4726168 missense probably damaging 1.00
R7635:Sptbn2 UTSW 19 4744207 missense probably damaging 1.00
R7733:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7738:Sptbn2 UTSW 19 4724125 missense probably damaging 1.00
R7742:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7767:Sptbn2 UTSW 19 4734143 missense possibly damaging 0.62
R7795:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7796:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7871:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7877:Sptbn2 UTSW 19 4744262 missense possibly damaging 0.93
R7920:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7921:Sptbn2 UTSW 19 4749012 missense probably benign 0.05
R7923:Sptbn2 UTSW 19 4746799 missense probably benign 0.01
R8137:Sptbn2 UTSW 19 4737403 missense possibly damaging 0.81
R8305:Sptbn2 UTSW 19 4729130 missense possibly damaging 0.81
V7580:Sptbn2 UTSW 19 4750632 missense probably damaging 1.00
Z1176:Sptbn2 UTSW 19 4738205 missense probably damaging 1.00
Z1176:Sptbn2 UTSW 19 4745191 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- ATCTTCGTGTTTAAGGGACAGAG -3'
(R):5'- CTGATCGTTTCCAGGCTCTG -3'

Sequencing Primer
(F):5'- CAGAGTTCTGTGGGCATCTAAG -3'
(R):5'- TTTCCAGGCTCTGCGGACTG -3'
Posted On2019-06-26