Incidental Mutation 'R7285:Gm340'
ID565969
Institutional Source Beutler Lab
Gene Symbol Gm340
Ensembl Gene ENSMUSG00000090673
Gene Namepredicted gene 340
SynonymsLOC381224
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.119) question?
Stock #R7285 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location41582370-41586536 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 41584315 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 503 (K503R)
Ref Sequence ENSEMBL: ENSMUSP00000128083 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000172371]
Predicted Effect possibly damaging
Transcript: ENSMUST00000172371
AA Change: K503R

PolyPhen 2 Score 0.914 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000128083
Gene: ENSMUSG00000090673
AA Change: K503R

DomainStartEndE-ValueType
low complexity region 10 17 N/A INTRINSIC
low complexity region 438 450 N/A INTRINSIC
low complexity region 710 724 N/A INTRINSIC
low complexity region 768 779 N/A INTRINSIC
Pfam:DUF4553 787 1241 9.7e-179 PFAM
Meta Mutation Damage Score 0.0624 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.7%
  • 20x: 98.9%
Validation Efficiency 100% (58/58)
Allele List at MGI
Other mutations in this stock
Total: 57 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210016F16Rik T C 13: 58,384,385 Y119C probably damaging Het
Abca12 A T 1: 71,349,155 C185* probably null Het
Abcc3 C T 11: 94,357,047 A1207T probably benign Het
Adam1b T G 5: 121,500,993 D663A probably damaging Het
Arhgap12 A T 18: 6,111,920 L148Q probably damaging Het
Cdh4 A T 2: 179,797,465 Q135L probably benign Het
Clca3b T C 3: 144,837,758 I437V probably benign Het
Cldn15 A T 5: 136,972,473 H124L probably benign Het
Cyp4a30b T C 4: 115,456,651 M143T probably damaging Het
Dgcr2 A T 16: 17,845,080 C353* probably null Het
Dhcr24 T A 4: 106,571,519 probably null Het
Dock1 T G 7: 134,745,008 L223R probably benign Het
Ece1 T A 4: 137,913,763 probably null Het
Efcab5 A G 11: 77,137,344 V387A probably benign Het
Efcab5 A G 11: 77,138,215 F97L possibly damaging Het
Eme2 A T 17: 24,894,569 probably null Het
Enpp1 G A 10: 24,660,161 T447I probably benign Het
Fam222b T C 11: 78,143,181 S17P probably benign Het
Fbln1 A G 15: 85,237,628 I317V probably benign Het
Fn1 T C 1: 71,637,339 K578E probably damaging Het
Fscb A T 12: 64,471,549 S1048T unknown Het
Fsd1l T A 4: 53,682,200 probably null Het
Hexa T A 9: 59,563,939 I492K probably benign Het
Inpp5e G A 2: 26,397,858 A642V probably benign Het
Ints11 C T 4: 155,886,111 A241V probably damaging Het
Irs2 A G 8: 11,006,797 L545P probably damaging Het
Katnal2 G A 18: 76,993,575 A409V probably benign Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Lbx2 A G 6: 83,087,896 K138R probably damaging Het
Lpp G A 16: 24,977,279 A558T probably damaging Het
Lypla1 T C 1: 4,841,098 I202T probably benign Het
Magi3 G A 3: 104,034,114 P842S probably benign Het
Meioc G A 11: 102,666,342 V25M probably benign Het
Mthfr C T 4: 148,053,599 T557I probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Olfr1165-ps A T 2: 88,101,705 I94N probably damaging Het
Olfr314 T A 11: 58,786,484 Y83* probably null Het
Osbpl10 A T 9: 115,223,703 I440F probably damaging Het
Otx2 G A 14: 48,661,465 A36V probably benign Het
Parg A G 14: 32,210,508 Y435C probably damaging Het
Parvb A T 15: 84,282,784 D100V possibly damaging Het
Prss27 A G 17: 24,045,691 H276R probably benign Het
Prune1 T A 3: 95,255,046 S439C probably damaging Het
Pudp C G 18: 50,568,216 E149Q possibly damaging Het
Sin3a C A 9: 57,127,299 T1252N possibly damaging Het
Sptbn2 A G 19: 4,737,443 D927G probably benign Het
Stx18 C T 5: 38,104,907 T89I possibly damaging Het
Ticrr T C 7: 79,660,862 S175P possibly damaging Het
Tinag T C 9: 77,045,661 T14A probably benign Het
Tmco3 G A 8: 13,319,605 probably null Het
Trpm1 G T 7: 64,209,981 E396* probably null Het
Txndc11 A G 16: 11,084,299 Y684H probably damaging Het
Usp47 G A 7: 112,093,108 E926K probably benign Het
Vmn1r233 A G 17: 20,993,959 I243T probably damaging Het
Ythdf3 T A 3: 16,203,885 probably null Het
Zfp12 A G 5: 143,244,689 K289R probably damaging Het
Zfp950 T A 19: 61,119,112 H511L probably benign Het
Other mutations in Gm340
AlleleSourceChrCoordTypePredicted EffectPPH Score
BB003:Gm340 UTSW 19 41582569 missense probably benign
BB013:Gm340 UTSW 19 41582569 missense probably benign
R0006:Gm340 UTSW 19 41584899 missense probably benign 0.00
R0686:Gm340 UTSW 19 41582372 missense possibly damaging 0.73
R1104:Gm340 UTSW 19 41586063 missense probably damaging 0.99
R1278:Gm340 UTSW 19 41584683 missense probably benign 0.07
R1606:Gm340 UTSW 19 41585074 missense probably benign 0.35
R1833:Gm340 UTSW 19 41584948 missense probably benign 0.00
R1905:Gm340 UTSW 19 41583574 missense possibly damaging 0.73
R2697:Gm340 UTSW 19 41584027 missense probably benign 0.43
R2881:Gm340 UTSW 19 41583049 missense probably damaging 1.00
R4720:Gm340 UTSW 19 41585895 missense probably benign 0.04
R4864:Gm340 UTSW 19 41585364 missense probably benign
R4908:Gm340 UTSW 19 41584162 missense probably benign 0.00
R5193:Gm340 UTSW 19 41582530 missense probably damaging 1.00
R5215:Gm340 UTSW 19 41585932 missense probably damaging 1.00
R5276:Gm340 UTSW 19 41585039 missense probably damaging 0.98
R5319:Gm340 UTSW 19 41586352 missense probably damaging 0.99
R5321:Gm340 UTSW 19 41585204 missense probably damaging 1.00
R5432:Gm340 UTSW 19 41584603 missense probably damaging 1.00
R5605:Gm340 UTSW 19 41582863 missense probably damaging 1.00
R5941:Gm340 UTSW 19 41586400 missense probably damaging 1.00
R6020:Gm340 UTSW 19 41583547 missense possibly damaging 0.88
R6024:Gm340 UTSW 19 41583957 missense possibly damaging 0.84
R6149:Gm340 UTSW 19 41585202 missense probably damaging 1.00
R6260:Gm340 UTSW 19 41582370 missense probably null 0.91
R6260:Gm340 UTSW 19 41582371 missense possibly damaging 0.73
R6476:Gm340 UTSW 19 41583079 missense probably benign 0.04
R7051:Gm340 UTSW 19 41585752 missense probably benign 0.05
R7372:Gm340 UTSW 19 41585506 missense probably damaging 1.00
R7762:Gm340 UTSW 19 41583667 missense probably benign 0.02
R7833:Gm340 UTSW 19 41584585 missense probably benign 0.02
R7926:Gm340 UTSW 19 41582569 missense probably benign
R8164:Gm340 UTSW 19 41585410 missense probably damaging 1.00
R8319:Gm340 UTSW 19 41582904 missense probably damaging 1.00
R8323:Gm340 UTSW 19 41583597 missense probably benign 0.01
R8327:Gm340 UTSW 19 41582557 missense probably damaging 1.00
X0013:Gm340 UTSW 19 41584532 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTTGCTAGATGACTCCCTGC -3'
(R):5'- TCAATCACTGGTCCCTCGGATG -3'

Sequencing Primer
(F):5'- AGATGACTCCCTGCCCCTC -3'
(R):5'- TCGGATGTCACCCTACCAGAG -3'
Posted On2019-06-26