Incidental Mutation 'R7286:Mga'
ID 565981
Institutional Source Beutler Lab
Gene Symbol Mga
Ensembl Gene ENSMUSG00000033943
Gene Name MAX gene associated
Synonyms D030062C11Rik, Mga, Mad5, C130042M01Rik
MMRRC Submission
Accession Numbers

Ncbi RefSeq: NM_013720.2, NM_001164274.1; MGI: 1352483

Essential gene? Probably essential (E-score: 0.943) question?
Stock # R7286 (G1)
Quality Score 225.009
Status Not validated
Chromosome 2
Chromosomal Location 119897228-119969581 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 119964788 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Arginine at position 2984 (S2984R)
Ref Sequence ENSEMBL: ENSMUSP00000106401 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046717] [ENSMUST00000079934] [ENSMUST00000110773] [ENSMUST00000110774] [ENSMUST00000156510]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000046717
AA Change: S2945R

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000043795
Gene: ENSMUSG00000033943
AA Change: S2945R

DomainStartEndE-ValueType
Blast:TBOX 6 73 6e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1248 1269 N/A INTRINSIC
low complexity region 1301 1315 N/A INTRINSIC
low complexity region 1564 1581 N/A INTRINSIC
low complexity region 1634 1649 N/A INTRINSIC
low complexity region 1681 1716 N/A INTRINSIC
low complexity region 1796 1818 N/A INTRINSIC
low complexity region 1833 1850 N/A INTRINSIC
low complexity region 1977 1992 N/A INTRINSIC
low complexity region 2183 2197 N/A INTRINSIC
low complexity region 2241 2259 N/A INTRINSIC
HLH 2368 2419 8.27e-7 SMART
low complexity region 2748 2769 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000079934
AA Change: S2775R

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000078853
Gene: ENSMUSG00000033943
AA Change: S2775R

DomainStartEndE-ValueType
Blast:TBOX 6 73 5e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1247 1268 N/A INTRINSIC
low complexity region 1300 1314 N/A INTRINSIC
low complexity region 1626 1648 N/A INTRINSIC
low complexity region 1663 1680 N/A INTRINSIC
low complexity region 1807 1822 N/A INTRINSIC
low complexity region 2013 2027 N/A INTRINSIC
low complexity region 2071 2089 N/A INTRINSIC
HLH 2198 2249 8.27e-7 SMART
low complexity region 2578 2599 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110773
AA Change: S2866R

PolyPhen 2 Score 0.827 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000106400
Gene: ENSMUSG00000033943
AA Change: S2866R

DomainStartEndE-ValueType
Blast:TBOX 6 73 5e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 890 899 N/A INTRINSIC
low complexity region 938 952 N/A INTRINSIC
low complexity region 1033 1059 N/A INTRINSIC
low complexity region 1169 1190 N/A INTRINSIC
low complexity region 1222 1236 N/A INTRINSIC
low complexity region 1485 1502 N/A INTRINSIC
low complexity region 1555 1570 N/A INTRINSIC
low complexity region 1602 1637 N/A INTRINSIC
low complexity region 1717 1739 N/A INTRINSIC
low complexity region 1754 1771 N/A INTRINSIC
low complexity region 1898 1913 N/A INTRINSIC
low complexity region 2104 2118 N/A INTRINSIC
low complexity region 2162 2180 N/A INTRINSIC
HLH 2289 2340 8.27e-7 SMART
low complexity region 2669 2690 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000110774
AA Change: S2984R

PolyPhen 2 Score 0.929 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000106401
Gene: ENSMUSG00000033943
AA Change: S2984R

DomainStartEndE-ValueType
Blast:TBOX 6 73 7e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
Pfam:DUF4801 1037 1085 1e-19 PFAM
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1248 1269 N/A INTRINSIC
low complexity region 1301 1315 N/A INTRINSIC
low complexity region 1564 1581 N/A INTRINSIC
low complexity region 1634 1649 N/A INTRINSIC
low complexity region 1681 1716 N/A INTRINSIC
low complexity region 1835 1857 N/A INTRINSIC
low complexity region 1872 1889 N/A INTRINSIC
low complexity region 2016 2031 N/A INTRINSIC
low complexity region 2222 2236 N/A INTRINSIC
low complexity region 2280 2298 N/A INTRINSIC
HLH 2407 2458 8.27e-7 SMART
low complexity region 2787 2808 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000156510
SMART Domains Protein: ENSMUSP00000119044
Gene: ENSMUSG00000033943

DomainStartEndE-ValueType
Blast:TBOX 6 73 4e-27 BLAST
TBOX 74 265 2.34e-100 SMART
low complexity region 969 978 N/A INTRINSIC
low complexity region 1017 1031 N/A INTRINSIC
low complexity region 1112 1138 N/A INTRINSIC
low complexity region 1247 1268 N/A INTRINSIC
low complexity region 1300 1314 N/A INTRINSIC
low complexity region 1626 1648 N/A INTRINSIC
low complexity region 1663 1680 N/A INTRINSIC
low complexity region 1807 1822 N/A INTRINSIC
low complexity region 2013 2027 N/A INTRINSIC
low complexity region 2071 2089 N/A INTRINSIC
HLH 2198 2249 8.27e-7 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Embryos homozygous for a gene trap allele die shortly after implantation due to defective development of the inner cell mass (ICM) and the epiblast. ICM derivatives fail to develop past E4.5 and show increased apoptosis but no change in cell proliferation. [provided by MGI curators]
Allele List at MGI

All alleles(135) : Gene trapped(135)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,622,479 C130S probably benign Het
4921501E09Rik T C 17: 33,065,527 D767G probably benign Het
4930550C14Rik A T 9: 53,423,017 M187L possibly damaging Het
9930012K11Rik T C 14: 70,157,237 E156G possibly damaging Het
Acad9 C T 3: 36,075,990 A194V probably damaging Het
Agps T A 2: 75,852,784 V151E probably benign Het
Ak9 A T 10: 41,407,371 I1273L Het
Akr1c19 T A 13: 4,246,819 L288Q probably damaging Het
Carmil1 T G 13: 24,013,394 D1353A probably damaging Het
Ccz1 T A 5: 144,013,079 I43F probably damaging Het
Cep70 G A 9: 99,275,585 C179Y probably damaging Het
Comt A T 16: 18,410,690 L196H probably damaging Het
Cspg5 A T 9: 110,246,955 D253V probably damaging Het
Dars2 A G 1: 161,046,808 V437A possibly damaging Het
Dcaf5 A G 12: 80,348,390 I335T probably damaging Het
Ddn T C 15: 98,806,025 K462R possibly damaging Het
Dscaml1 T C 9: 45,742,746 probably null Het
Ethe1 A G 7: 24,607,952 Y197C probably damaging Het
Evc A T 5: 37,322,183 L269* probably null Het
Fam161a T C 11: 23,020,001 S60P possibly damaging Het
Fam20b A G 1: 156,681,442 V400A probably benign Het
Fam53b T A 7: 132,759,661 S213C possibly damaging Het
Flot2 A G 11: 78,054,786 I45V probably benign Het
Gemin4 A C 11: 76,212,753 L394R probably damaging Het
Glis2 T G 16: 4,611,318 S128R possibly damaging Het
Gm3696 A G 14: 7,089,808 Y92H probably damaging Het
Gm49333 T C 16: 20,632,591 S325P probably benign Het
Gpbp1l1 T C 4: 116,590,245 V374A probably benign Het
Grm1 T C 10: 10,689,696 N956S probably benign Het
Hbb-bh1 T C 7: 103,843,031 E27G probably damaging Het
Hmcn1 A T 1: 150,582,337 C5233S probably damaging Het
Hmgcr C T 13: 96,666,597 C30Y probably damaging Het
Hoxb6 A G 11: 96,292,825 probably benign Het
Igf2 T C 7: 142,655,818 Q35R possibly damaging Het
Ighv1-4 C T 12: 114,487,321 V56I probably benign Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Lmtk2 C T 5: 144,174,360 Q633* probably null Het
Mesd T C 7: 83,895,749 Y136H probably damaging Het
Mkrn3 T C 7: 62,418,927 N372S probably benign Het
Mtpap A G 18: 4,387,068 I373V probably benign Het
Mycbp2 G A 14: 103,120,591 T4589M probably damaging Het
Myh2 A G 11: 67,188,369 Q921R probably benign Het
Myom1 A G 17: 71,045,549 D324G possibly damaging Het
Nat10 T C 2: 103,754,169 K88E probably benign Het
Ncapd3 A G 9: 27,069,958 R915G probably damaging Het
Nek4 T C 14: 30,957,292 Y190H probably damaging Het
Nfasc A C 1: 132,602,052 Y797D probably damaging Het
Ngp A G 9: 110,420,910 D92G probably benign Het
Nos2 A C 11: 78,929,854 H95P probably damaging Het
Nr3c1 ACGTC ACGTCGTC 18: 39,486,460 probably benign Het
Olfr1129 C T 2: 87,575,519 T145I probably benign Het
Olfr1350 C A 7: 6,570,716 H242N probably damaging Het
Olfr141 A T 2: 86,806,623 H125Q possibly damaging Het
Olfr498 T C 7: 108,465,435 I37T possibly damaging Het
Otogl T A 10: 107,770,610 D2154V probably benign Het
Pdss1 T A 2: 22,935,641 probably null Het
Pex5 A T 6: 124,398,063 L609* probably null Het
Pglyrp4 C A 3: 90,732,974 A177D probably damaging Het
Phactr4 A G 4: 132,377,178 probably null Het
Pik3cd G C 4: 149,659,714 N193K probably benign Het
Prr36 TACCTCTTC T 8: 4,215,163 probably benign Het
Prss38 A T 11: 59,375,558 W25R probably benign Het
Prss8 T A 7: 127,926,884 Q189L probably damaging Het
Psd T A 19: 46,314,801 D713V probably damaging Het
Rad51ap2 C T 12: 11,457,691 T538I probably benign Het
Rarres1 T C 3: 67,515,184 T78A probably benign Het
Rbl2 G T 8: 91,102,294 G651* probably null Het
Rev3l A T 10: 39,823,605 Q1366L probably damaging Het
Rundc1 T C 11: 101,429,587 S215P probably benign Het
Scarf2 G A 16: 17,802,973 W168* probably null Het
Sh2d7 A G 9: 54,540,902 D69G possibly damaging Het
Slc26a4 A T 12: 31,529,528 Y578* probably null Het
Slc2a9 A T 5: 38,453,195 L87Q probably damaging Het
Slc39a10 A T 1: 46,810,070 H795Q probably damaging Het
Spata13 C T 14: 60,756,422 R1108W probably damaging Het
Sqle T C 15: 59,316,052 S70P probably benign Het
Syncrip A T 9: 88,464,663 F263I probably damaging Het
Synj2 T C 17: 6,037,945 S1424P possibly damaging Het
Tax1bp3 A T 11: 73,181,115 T89S possibly damaging Het
Tcaim G A 9: 122,819,027 probably null Het
Tcp10c T C 17: 13,362,176 I240T possibly damaging Het
Ttll8 G T 15: 88,917,239 N415K probably benign Het
Ugcg T C 4: 59,217,111 S212P possibly damaging Het
Vmn2r32 T C 7: 7,479,808 K56E probably benign Het
Vmn2r55 T C 7: 12,652,073 E660G probably damaging Het
Vmn2r7 T C 3: 64,690,880 N752S probably benign Het
Vps54 T A 11: 21,275,005 M167K probably benign Het
Vwa2 A C 19: 56,909,359 M699L probably benign Het
Wdr59 A G 8: 111,465,862 V689A Het
Whamm T G 7: 81,586,247 N399K probably damaging Het
Zcchc6 T C 13: 59,821,649 E144G probably benign Het
Zfp760 A G 17: 21,722,779 K312E probably benign Het
Zkscan3 C A 13: 21,394,813 V171L probably benign Het
Other mutations in Mga
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00551:Mga APN 2 119919814 missense possibly damaging 0.65
IGL00719:Mga APN 2 119947453 nonsense probably null
IGL01619:Mga APN 2 119931828 missense possibly damaging 0.46
IGL01721:Mga APN 2 119935239 missense probably damaging 1.00
IGL01759:Mga APN 2 119951195 missense possibly damaging 0.92
IGL01785:Mga APN 2 119902912 missense probably damaging 1.00
IGL01786:Mga APN 2 119902912 missense probably damaging 1.00
IGL01950:Mga APN 2 119941654 missense possibly damaging 0.60
IGL01960:Mga APN 2 119938657 missense probably damaging 1.00
IGL02086:Mga APN 2 119924036 missense probably damaging 0.99
IGL02364:Mga APN 2 119964054 missense possibly damaging 0.66
IGL02602:Mga APN 2 119931884 missense possibly damaging 0.66
IGL02751:Mga APN 2 119947770 missense possibly damaging 0.82
IGL02794:Mga APN 2 119946289 missense possibly damaging 0.84
IGL03247:Mga APN 2 119935513 missense possibly damaging 0.81
IGL03303:Mga APN 2 119903452 missense probably damaging 1.00
PIT4515001:Mga UTSW 2 119916504 missense probably damaging 1.00
R0060:Mga UTSW 2 119960961 critical splice donor site probably null
R0060:Mga UTSW 2 119960961 critical splice donor site probably null
R0417:Mga UTSW 2 119902790 missense probably damaging 0.99
R0449:Mga UTSW 2 119941381 missense probably damaging 1.00
R0457:Mga UTSW 2 119916488 missense probably damaging 0.98
R0538:Mga UTSW 2 119919706 critical splice donor site probably null
R0568:Mga UTSW 2 119935422 missense probably damaging 1.00
R0614:Mga UTSW 2 119964466 missense probably damaging 1.00
R0671:Mga UTSW 2 119919910 splice site probably null
R0811:Mga UTSW 2 119947961 missense probably damaging 0.99
R0812:Mga UTSW 2 119947961 missense probably damaging 0.99
R0948:Mga UTSW 2 119941659 missense possibly damaging 0.77
R1177:Mga UTSW 2 119926446 missense probably damaging 1.00
R1445:Mga UTSW 2 119902698 missense probably damaging 1.00
R1476:Mga UTSW 2 119941675 missense probably damaging 0.96
R1527:Mga UTSW 2 119916597 missense probably damaging 1.00
R1583:Mga UTSW 2 119963960 missense possibly damaging 0.66
R1592:Mga UTSW 2 119964666 missense possibly damaging 0.93
R1627:Mga UTSW 2 119964562 missense probably damaging 1.00
R1658:Mga UTSW 2 119941689 missense possibly damaging 0.63
R1677:Mga UTSW 2 119960852 missense possibly damaging 0.92
R1887:Mga UTSW 2 119923617 missense probably damaging 1.00
R1908:Mga UTSW 2 119926594 missense possibly damaging 0.66
R1909:Mga UTSW 2 119926594 missense possibly damaging 0.66
R2061:Mga UTSW 2 119964980 unclassified probably benign
R2145:Mga UTSW 2 119964157 missense possibly damaging 0.85
R2159:Mga UTSW 2 119919643 missense probably damaging 0.96
R2179:Mga UTSW 2 119960442 missense probably damaging 0.99
R2281:Mga UTSW 2 119903723 missense probably benign
R2423:Mga UTSW 2 119964793 missense probably damaging 1.00
R3620:Mga UTSW 2 119916668 missense probably damaging 1.00
R3622:Mga UTSW 2 119941764 missense probably damaging 1.00
R3624:Mga UTSW 2 119941764 missense probably damaging 1.00
R3802:Mga UTSW 2 119947339 missense probably damaging 0.96
R4011:Mga UTSW 2 119931780 missense probably damaging 1.00
R4065:Mga UTSW 2 119947002 missense probably damaging 1.00
R4520:Mga UTSW 2 119948098 missense possibly damaging 0.85
R4649:Mga UTSW 2 119941493 missense possibly damaging 0.81
R4660:Mga UTSW 2 119938623 intron probably benign
R4757:Mga UTSW 2 119903639 missense possibly damaging 0.82
R4771:Mga UTSW 2 119964294 missense probably damaging 1.00
R4784:Mga UTSW 2 119903057 missense probably damaging 1.00
R4866:Mga UTSW 2 119964054 missense possibly damaging 0.66
R4900:Mga UTSW 2 119964054 missense possibly damaging 0.66
R4952:Mga UTSW 2 119903301 missense probably damaging 1.00
R4995:Mga UTSW 2 119932582 nonsense probably null
R5020:Mga UTSW 2 119951173 nonsense probably null
R5082:Mga UTSW 2 119903344 missense probably damaging 0.98
R5208:Mga UTSW 2 119947981 missense possibly damaging 0.83
R5454:Mga UTSW 2 119903329 missense probably damaging 0.99
R5466:Mga UTSW 2 119902697 missense probably damaging 1.00
R5484:Mga UTSW 2 119916626 missense possibly damaging 0.58
R5669:Mga UTSW 2 119903426 missense probably damaging 1.00
R5819:Mga UTSW 2 119941263 missense possibly damaging 0.61
R5916:Mga UTSW 2 119964312 missense probably benign 0.27
R5942:Mga UTSW 2 119946959 missense probably benign 0.41
R6305:Mga UTSW 2 119947698 missense probably benign 0.00
R6434:Mga UTSW 2 119923938 missense probably damaging 0.99
R6467:Mga UTSW 2 119946295 missense probably damaging 1.00
R6488:Mga UTSW 2 119960907 missense probably damaging 1.00
R6630:Mga UTSW 2 119923659 missense probably damaging 0.99
R6790:Mga UTSW 2 119923754 missense probably damaging 0.99
R7029:Mga UTSW 2 119923550 missense probably damaging 1.00
R7039:Mga UTSW 2 119932678 missense probably benign 0.28
R7088:Mga UTSW 2 119961936 missense probably damaging 1.00
R7195:Mga UTSW 2 119917328 missense probably damaging 1.00
R7273:Mga UTSW 2 119935214 missense probably damaging 1.00
R7346:Mga UTSW 2 119935527 missense possibly damaging 0.56
R7383:Mga UTSW 2 119960340 missense probably damaging 0.99
R7469:Mga UTSW 2 119903046 missense probably damaging 1.00
R7484:Mga UTSW 2 119946229 missense probably damaging 0.99
R7537:Mga UTSW 2 119935551 missense probably damaging 0.97
R7781:Mga UTSW 2 119917357 missense probably damaging 1.00
R7921:Mga UTSW 2 119919678 missense probably damaging 1.00
R8165:Mga UTSW 2 119947238 missense probably benign 0.12
R8226:Mga UTSW 2 119960385 missense probably benign 0.33
R8305:Mga UTSW 2 119946319 missense possibly damaging 0.77
R8309:Mga UTSW 2 119960930 missense probably damaging 1.00
R8363:Mga UTSW 2 119963926 missense probably benign 0.43
R8388:Mga UTSW 2 119964081 missense probably benign 0.00
R8524:Mga UTSW 2 119941516 missense probably damaging 0.97
R8693:Mga UTSW 2 119963926 missense possibly damaging 0.65
R8837:Mga UTSW 2 119938791 splice site probably benign
R8916:Mga UTSW 2 119958338 missense possibly damaging 0.92
R8936:Mga UTSW 2 119964228 missense probably damaging 1.00
R9028:Mga UTSW 2 119947589 missense probably benign
R9145:Mga UTSW 2 119964012 missense probably benign
R9155:Mga UTSW 2 119926532 missense probably damaging 1.00
R9308:Mga UTSW 2 119923888 missense possibly damaging 0.91
R9342:Mga UTSW 2 119948175 missense probably benign
R9347:Mga UTSW 2 119903037 missense probably damaging 1.00
R9390:Mga UTSW 2 119963851 missense probably damaging 0.99
R9408:Mga UTSW 2 119935518 missense possibly damaging 0.92
R9488:Mga UTSW 2 119964823 missense possibly damaging 0.90
R9495:Mga UTSW 2 119951195 missense possibly damaging 0.92
R9521:Mga UTSW 2 119964498 missense probably damaging 0.99
R9780:Mga UTSW 2 119916772 missense probably benign 0.26
Predicted Primers PCR Primer
(F):5'- AGAGTACTTCTGGTCTCCCC -3'
(R):5'- AAAGGAGGTGAAATTCATTTCCCC -3'

Sequencing Primer
(F):5'- CGCAGAGCCTGAAAGTGTATCTTC -3'
(R):5'- GAGGATGAACAAGCTCATTTCCCTG -3'
Posted On 2019-06-26