Mutagenetix > Incidental Mutation

Incidental Mutation 'R7286:Dscaml1'

566011

Institutional Source

Beutler Lab

Gene Symbol

Dscaml1

Ensembl Gene

ENSMUSG00000032087

Gene Name

DS cell adhesion molecule like 1

Synonyms

4921507G06Rik, 4930435C18Rik

MMRRC Submission

Accession Numbers

Genbank: NM_001081270; MGI: 2150309

Essential gene?

Possibly non essential (E-score: 0.494) question?

Stock #

R7286 (G1)

Quality Score

152.008

Status

Not validated

Chromosome

Chromosomal Location

45426628-45753712 bp(+) (GRCm38)

Type of Mutation

critical splice donor site (2 bp from exon)

DNA Base Change (assembly)

T to C at 45742746 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000034592 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034592]

AlphaFold

Q4VA61

Predicted Effect

probably null
Transcript: ENSMUST00000034592

SMART Domains

Protein: ENSMUSP00000034592
Gene: ENSMUSG00000032087

Domain	Start	End	E-Value	Type
low complexity region	3	17	N/A	INTRINSIC
low complexity region	28	55	N/A	INTRINSIC
IG_like	96	168	1.22e0	SMART
IG	189	277	1.15e-3	SMART
IGc2	296	359	2.54e-14	SMART
IGc2	385	451	8.12e-13	SMART
IGc2	478	550	9.55e-10	SMART
IGc2	575	640	9.78e-7	SMART
IGc2	666	734	5.93e-6	SMART
IGc2	760	832	6.75e-10	SMART
IG	853	943	1e-3	SMART
FN3	945	1029	6.64e-7	SMART
FN3	1045	1133	9.46e-12	SMART
FN3	1148	1234	3.2e-9	SMART
FN3	1249	1332	3.48e-10	SMART
IGc2	1363	1428	1.49e-11	SMART
FN3	1442	1522	3.42e-9	SMART
FN3	1537	1618	2.14e-1	SMART
low complexity region	1671	1683	N/A	INTRINSIC
low complexity region	2018	2026	N/A	INTRINSIC
low complexity region	2035	2069	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000216685

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Ig superfamily of cell adhesion molecules and is involved in neuronal differentiation. The encoded membrane-bound protein localizes to the cell surface, where it forms aggregates that repel neuronal processes of the same cell type. [provided by RefSeq, Sep 2016]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit impaired self-avoidance in multiple cell types in the retina. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Gene trapped(4)

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	T	11: 23,622,479	C130S	probably benign	Het
4921501E09Rik	T	C	17: 33,065,527	D767G	probably benign	Het
4930550C14Rik	A	T	9: 53,423,017	M187L	possibly damaging	Het
9930012K11Rik	T	C	14: 70,157,237	E156G	possibly damaging	Het
Acad9	C	T	3: 36,075,990	A194V	probably damaging	Het
Agps	T	A	2: 75,852,784	V151E	probably benign	Het
Ak9	A	T	10: 41,407,371	I1273L		Het
Akr1c19	T	A	13: 4,246,819	L288Q	probably damaging	Het
Carmil1	T	G	13: 24,013,394	D1353A	probably damaging	Het
Ccz1	T	A	5: 144,013,079	I43F	probably damaging	Het
Cep70	G	A	9: 99,275,585	C179Y	probably damaging	Het
Comt	A	T	16: 18,410,690	L196H	probably damaging	Het
Cspg5	A	T	9: 110,246,955	D253V	probably damaging	Het
Dars2	A	G	1: 161,046,808	V437A	possibly damaging	Het
Dcaf5	A	G	12: 80,348,390	I335T	probably damaging	Het
Ddn	T	C	15: 98,806,025	K462R	possibly damaging	Het
Ethe1	A	G	7: 24,607,952	Y197C	probably damaging	Het
Evc	A	T	5: 37,322,183	L269*	probably null	Het
Fam161a	T	C	11: 23,020,001	S60P	possibly damaging	Het
Fam20b	A	G	1: 156,681,442	V400A	probably benign	Het
Fam53b	T	A	7: 132,759,661	S213C	possibly damaging	Het
Flot2	A	G	11: 78,054,786	I45V	probably benign	Het
Gemin4	A	C	11: 76,212,753	L394R	probably damaging	Het
Glis2	T	G	16: 4,611,318	S128R	possibly damaging	Het
Gm3696	A	G	14: 7,089,808	Y92H	probably damaging	Het
Gm49333	T	C	16: 20,632,591	S325P	probably benign	Het
Gpbp1l1	T	C	4: 116,590,245	V374A	probably benign	Het
Grm1	T	C	10: 10,689,696	N956S	probably benign	Het
Hbb-bh1	T	C	7: 103,843,031	E27G	probably damaging	Het
Hmcn1	A	T	1: 150,582,337	C5233S	probably damaging	Het
Hmgcr	C	T	13: 96,666,597	C30Y	probably damaging	Het
Hoxb6	A	G	11: 96,292,825		probably benign	Het
Igf2	T	C	7: 142,655,818	Q35R	possibly damaging	Het
Ighv1-4	C	T	12: 114,487,321	V56I	probably benign	Het
Kif13a	C	T	13: 46,752,455	V671M	possibly damaging	Het
Lmtk2	C	T	5: 144,174,360	Q633*	probably null	Het
Mesd	T	C	7: 83,895,749	Y136H	probably damaging	Het
Mga	T	A	2: 119,964,788	S2984R	possibly damaging	Het
Mkrn3	T	C	7: 62,418,927	N372S	probably benign	Het
Mtpap	A	G	18: 4,387,068	I373V	probably benign	Het
Mycbp2	G	A	14: 103,120,591	T4589M	probably damaging	Het
Myh2	A	G	11: 67,188,369	Q921R	probably benign	Het
Myom1	A	G	17: 71,045,549	D324G	possibly damaging	Het
Nat10	T	C	2: 103,754,169	K88E	probably benign	Het
Ncapd3	A	G	9: 27,069,958	R915G	probably damaging	Het
Nek4	T	C	14: 30,957,292	Y190H	probably damaging	Het
Nfasc	A	C	1: 132,602,052	Y797D	probably damaging	Het
Ngp	A	G	9: 110,420,910	D92G	probably benign	Het
Nos2	A	C	11: 78,929,854	H95P	probably damaging	Het
Nr3c1	ACGTC	ACGTCGTC	18: 39,486,460		probably benign	Het
Olfr1129	C	T	2: 87,575,519	T145I	probably benign	Het
Olfr1350	C	A	7: 6,570,716	H242N	probably damaging	Het
Olfr141	A	T	2: 86,806,623	H125Q	possibly damaging	Het
Olfr498	T	C	7: 108,465,435	I37T	possibly damaging	Het
Otogl	T	A	10: 107,770,610	D2154V	probably benign	Het
Pdss1	T	A	2: 22,935,641		probably null	Het
Pex5	A	T	6: 124,398,063	L609*	probably null	Het
Pglyrp4	C	A	3: 90,732,974	A177D	probably damaging	Het
Phactr4	A	G	4: 132,377,178		probably null	Het
Pik3cd	G	C	4: 149,659,714	N193K	probably benign	Het
Prr36	TACCTCTTC	T	8: 4,215,163		probably benign	Het
Prss38	A	T	11: 59,375,558	W25R	probably benign	Het
Prss8	T	A	7: 127,926,884	Q189L	probably damaging	Het
Psd	T	A	19: 46,314,801	D713V	probably damaging	Het
Rad51ap2	C	T	12: 11,457,691	T538I	probably benign	Het
Rarres1	T	C	3: 67,515,184	T78A	probably benign	Het
Rbl2	G	T	8: 91,102,294	G651*	probably null	Het
Rev3l	A	T	10: 39,823,605	Q1366L	probably damaging	Het
Rundc1	T	C	11: 101,429,587	S215P	probably benign	Het
Scarf2	G	A	16: 17,802,973	W168*	probably null	Het
Sh2d7	A	G	9: 54,540,902	D69G	possibly damaging	Het
Slc26a4	A	T	12: 31,529,528	Y578*	probably null	Het
Slc2a9	A	T	5: 38,453,195	L87Q	probably damaging	Het
Slc39a10	A	T	1: 46,810,070	H795Q	probably damaging	Het
Spata13	C	T	14: 60,756,422	R1108W	probably damaging	Het
Sqle	T	C	15: 59,316,052	S70P	probably benign	Het
Syncrip	A	T	9: 88,464,663	F263I	probably damaging	Het
Synj2	T	C	17: 6,037,945	S1424P	possibly damaging	Het
Tax1bp3	A	T	11: 73,181,115	T89S	possibly damaging	Het
Tcaim	G	A	9: 122,819,027		probably null	Het
Tcp10c	T	C	17: 13,362,176	I240T	possibly damaging	Het
Ttll8	G	T	15: 88,917,239	N415K	probably benign	Het
Ugcg	T	C	4: 59,217,111	S212P	possibly damaging	Het
Vmn2r32	T	C	7: 7,479,808	K56E	probably benign	Het
Vmn2r55	T	C	7: 12,652,073	E660G	probably damaging	Het
Vmn2r7	T	C	3: 64,690,880	N752S	probably benign	Het
Vps54	T	A	11: 21,275,005	M167K	probably benign	Het
Vwa2	A	C	19: 56,909,359	M699L	probably benign	Het
Wdr59	A	G	8: 111,465,862	V689A		Het
Whamm	T	G	7: 81,586,247	N399K	probably damaging	Het
Zcchc6	T	C	13: 59,821,649	E144G	probably benign	Het
Zfp760	A	G	17: 21,722,779	K312E	probably benign	Het
Zkscan3	C	A	13: 21,394,813	V171L	probably benign	Het

Other mutations in Dscaml1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00418:Dscaml1	APN	9	45670200	nonsense	probably null
IGL00497:Dscaml1	APN	9	45752238	missense	probably damaging	1.00
IGL00895:Dscaml1	APN	9	45751253	missense	probably damaging	0.99
IGL01011:Dscaml1	APN	9	45683672	missense	possibly damaging	0.76
IGL01086:Dscaml1	APN	9	45702662	splice site	probably benign
IGL01125:Dscaml1	APN	9	45749632	critical splice acceptor site	probably null
IGL01132:Dscaml1	APN	9	45752328	nonsense	probably null
IGL01356:Dscaml1	APN	9	45746857	missense	probably benign	0.03
IGL01459:Dscaml1	APN	9	45742683	nonsense	probably null
IGL01552:Dscaml1	APN	9	45447908	missense	probably damaging	1.00
IGL02033:Dscaml1	APN	9	45683782	missense	probably damaging	1.00
IGL02044:Dscaml1	APN	9	45746943	nonsense	probably null
IGL02095:Dscaml1	APN	9	45447703	missense	probably damaging	1.00
IGL02166:Dscaml1	APN	9	45683701	missense	probably damaging	0.98
IGL02262:Dscaml1	APN	9	45745116	missense	probably benign
IGL02262:Dscaml1	APN	9	45732080	missense	probably benign	0.44
IGL02340:Dscaml1	APN	9	45670176	missense	possibly damaging	0.66
IGL02604:Dscaml1	APN	9	45744328	unclassified	probably benign
IGL02619:Dscaml1	APN	9	45447796	missense	probably damaging	1.00
IGL02805:Dscaml1	APN	9	45447897	missense	probably damaging	0.98
IGL03409:Dscaml1	APN	9	45670103	missense	probably damaging	1.00
D3080:Dscaml1	UTSW	9	45684325	missense	probably benign	0.44
IGL03050:Dscaml1	UTSW	9	45742999	missense	probably damaging	1.00
R0149:Dscaml1	UTSW	9	45742680	nonsense	probably null
R0582:Dscaml1	UTSW	9	45668264	missense	possibly damaging	0.77
R0629:Dscaml1	UTSW	9	45721418	missense	probably damaging	0.98
R0632:Dscaml1	UTSW	9	45732134	missense	probably benign	0.06
R0815:Dscaml1	UTSW	9	45745074	missense	probably benign	0.00
R1162:Dscaml1	UTSW	9	45752349	splice site	probably benign
R1449:Dscaml1	UTSW	9	45742223	missense	possibly damaging	0.95
R1474:Dscaml1	UTSW	9	45685221	missense	probably damaging	1.00
R1481:Dscaml1	UTSW	9	45672643	missense	probably benign	0.01
R1533:Dscaml1	UTSW	9	45450584	missense	probably damaging	0.99
R1542:Dscaml1	UTSW	9	45749440	missense	possibly damaging	0.84
R1572:Dscaml1	UTSW	9	45721333	missense	probably benign	0.00
R1627:Dscaml1	UTSW	9	45753147	missense	probably damaging	1.00
R1634:Dscaml1	UTSW	9	45672749	missense	probably damaging	1.00
R1713:Dscaml1	UTSW	9	45752690	missense	possibly damaging	0.49
R1777:Dscaml1	UTSW	9	45683756	missense	possibly damaging	0.58
R1812:Dscaml1	UTSW	9	45751286	critical splice donor site	probably null
R1834:Dscaml1	UTSW	9	45683632	missense	probably benign	0.00
R1907:Dscaml1	UTSW	9	45740480	missense	probably damaging	1.00
R1953:Dscaml1	UTSW	9	45670224	missense	probably benign	0.01
R2056:Dscaml1	UTSW	9	45750132	missense	probably damaging	0.99
R2193:Dscaml1	UTSW	9	45685234	missense	probably benign	0.21
R2497:Dscaml1	UTSW	9	45745078	missense	probably benign	0.00
R3768:Dscaml1	UTSW	9	45732137	missense	possibly damaging	0.94
R3891:Dscaml1	UTSW	9	45717484	missense	possibly damaging	0.84
R4110:Dscaml1	UTSW	9	45732068	missense	probably benign	0.07
R4706:Dscaml1	UTSW	9	45450580	missense	probably damaging	1.00
R4716:Dscaml1	UTSW	9	45450592	missense	probably damaging	1.00
R4719:Dscaml1	UTSW	9	45672695	missense	probably benign	0.13
R4770:Dscaml1	UTSW	9	45670106	missense	probably damaging	1.00
R4924:Dscaml1	UTSW	9	45745189	missense	probably damaging	1.00
R5167:Dscaml1	UTSW	9	45717432	missense	probably damaging	1.00
R5346:Dscaml1	UTSW	9	45450559	missense	possibly damaging	0.63
R5737:Dscaml1	UTSW	9	45745185	missense	probably damaging	0.99
R5977:Dscaml1	UTSW	9	45721298	missense	probably benign	0.19
R6073:Dscaml1	UTSW	9	45450583	missense	probably benign	0.22
R6276:Dscaml1	UTSW	9	45668160	missense	possibly damaging	0.62
R6415:Dscaml1	UTSW	9	45683677	nonsense	probably null
R6527:Dscaml1	UTSW	9	45712184	nonsense	probably null
R6582:Dscaml1	UTSW	9	45752806	missense	probably benign	0.00
R6655:Dscaml1	UTSW	9	45746937	missense	probably benign	0.00
R6772:Dscaml1	UTSW	9	45710311	missense	probably damaging	1.00
R6799:Dscaml1	UTSW	9	45450583	missense	probably benign	0.22
R6892:Dscaml1	UTSW	9	45683830	missense	probably damaging	0.99
R6918:Dscaml1	UTSW	9	45430507	missense	probably benign
R6967:Dscaml1	UTSW	9	45674523	missense	probably damaging	0.97
R7214:Dscaml1	UTSW	9	45670139	missense	probably benign	0.01
R7315:Dscaml1	UTSW	9	45745125	missense	probably benign	0.00
R7338:Dscaml1	UTSW	9	45674504	missense	probably benign	0.12
R7343:Dscaml1	UTSW	9	45752916	missense	probably benign
R7395:Dscaml1	UTSW	9	45702405	missense	possibly damaging	0.73
R7439:Dscaml1	UTSW	9	45710326	missense	possibly damaging	0.94
R7484:Dscaml1	UTSW	9	45749446	splice site	probably null
R7545:Dscaml1	UTSW	9	45685383	missense	probably benign	0.11
R7979:Dscaml1	UTSW	9	45683731	missense	probably damaging	1.00
R8005:Dscaml1	UTSW	9	45717510	missense	probably damaging	1.00
R8181:Dscaml1	UTSW	9	45746842	missense	possibly damaging	0.86
R8262:Dscaml1	UTSW	9	45747140	intron	probably benign
R8428:Dscaml1	UTSW	9	45742586	missense	probably benign	0.00
R8725:Dscaml1	UTSW	9	45430461	missense	probably benign	0.00
R8727:Dscaml1	UTSW	9	45430461	missense	probably benign	0.00
R8796:Dscaml1	UTSW	9	45447728	missense	probably damaging	0.99
R8840:Dscaml1	UTSW	9	45723420	missense	probably damaging	0.99
R9291:Dscaml1	UTSW	9	45447953	missense	probably damaging	1.00
R9394:Dscaml1	UTSW	9	45750056	missense	possibly damaging	0.64
R9610:Dscaml1	UTSW	9	45668224	missense	possibly damaging	0.95
R9611:Dscaml1	UTSW	9	45668224	missense	possibly damaging	0.95
R9653:Dscaml1	UTSW	9	45732168	critical splice donor site	probably null
R9699:Dscaml1	UTSW	9	45743017	missense	probably damaging	0.97
X0058:Dscaml1	UTSW	9	45752128	missense	probably benign	0.00
Z1177:Dscaml1	UTSW	9	45672791	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- TGGTCTGGCAGTGAAGACTC -3'
(R):5'- GCTCTCAGTGCAAAAGGTCTGG -3'

Sequencing Primer
(F):5'- TCTGGCAGTGAAGACTCAGCAATC -3'
(R):5'- TGCAAAAGGTCTGGAGTGTCCC -3'

Posted On

2019-06-26