Mutagenetix > Incidental Mutation

Incidental Mutation 'R7286:Otogl'

566022

Institutional Source

Beutler Lab

Gene Symbol

Otogl

Ensembl Gene

ENSMUSG00000091455

Gene Name

otogelin-like

Synonyms

Gm6924

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7286 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

107760531-107912134 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 107770610 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Valine at position 2154 (D2154V)

Ref Sequence

ENSEMBL: ENSMUSP00000129467 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000165341]

AlphaFold

F7A4A7

Predicted Effect

probably benign
Transcript: ENSMUST00000165341
AA Change: D2154V

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)

SMART Domains

Protein: ENSMUSP00000129467
Gene: ENSMUSG00000091455
AA Change: D2154V

Domain	Start	End	E-Value	Type
signal peptide	1	22	N/A	INTRINSIC
EGF_like	71	101	3.36e1	SMART
VWD	104	264	4.74e-29	SMART
C8	305	378	6.13e-6	SMART
VWD	463	625	7e-41	SMART
C8	668	733	3.6e-3	SMART
Pfam:TIL	736	791	2.3e-11	PFAM
SCOP:d1coua_	833	911	1e-6	SMART
VWD	928	1085	1.29e-30	SMART
C8	1120	1194	1.81e-26	SMART
Pfam:AbfB	1230	1350	1.2e-10	PFAM
Pfam:TIL	1364	1418	6.1e-8	PFAM
VWD	1497	1671	2.34e-10	SMART
C8	1705	1775	9.56e-17	SMART
Pfam:TIL	1778	1836	1.6e-8	PFAM
low complexity region	1870	1886	N/A	INTRINSIC
CT	2242	2325	6.9e-14	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the otogelin family. This gene is expressed in the inner ear of vertebrates with the highest level of expression seen at the embryonic stage and lowest in adult. Knockdown studies in zebrafish suggest that this gene is essential for normal inner ear function. Mutations in this gene are associated with autosomal recessive deafness. [provided by RefSeq, Dec 2012]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	T	11: 23,622,479	C130S	probably benign	Het
4921501E09Rik	T	C	17: 33,065,527	D767G	probably benign	Het
4930550C14Rik	A	T	9: 53,423,017	M187L	possibly damaging	Het
9930012K11Rik	T	C	14: 70,157,237	E156G	possibly damaging	Het
Acad9	C	T	3: 36,075,990	A194V	probably damaging	Het
Agps	T	A	2: 75,852,784	V151E	probably benign	Het
Ak9	A	T	10: 41,407,371	I1273L		Het
Akr1c19	T	A	13: 4,246,819	L288Q	probably damaging	Het
Carmil1	T	G	13: 24,013,394	D1353A	probably damaging	Het
Ccz1	T	A	5: 144,013,079	I43F	probably damaging	Het
Cep70	G	A	9: 99,275,585	C179Y	probably damaging	Het
Comt	A	T	16: 18,410,690	L196H	probably damaging	Het
Cspg5	A	T	9: 110,246,955	D253V	probably damaging	Het
Dars2	A	G	1: 161,046,808	V437A	possibly damaging	Het
Dcaf5	A	G	12: 80,348,390	I335T	probably damaging	Het
Ddn	T	C	15: 98,806,025	K462R	possibly damaging	Het
Dscaml1	T	C	9: 45,742,746		probably null	Het
Ethe1	A	G	7: 24,607,952	Y197C	probably damaging	Het
Evc	A	T	5: 37,322,183	L269*	probably null	Het
Fam161a	T	C	11: 23,020,001	S60P	possibly damaging	Het
Fam20b	A	G	1: 156,681,442	V400A	probably benign	Het
Fam53b	T	A	7: 132,759,661	S213C	possibly damaging	Het
Flot2	A	G	11: 78,054,786	I45V	probably benign	Het
Gemin4	A	C	11: 76,212,753	L394R	probably damaging	Het
Glis2	T	G	16: 4,611,318	S128R	possibly damaging	Het
Gm3696	A	G	14: 7,089,808	Y92H	probably damaging	Het
Gm49333	T	C	16: 20,632,591	S325P	probably benign	Het
Gpbp1l1	T	C	4: 116,590,245	V374A	probably benign	Het
Grm1	T	C	10: 10,689,696	N956S	probably benign	Het
Hbb-bh1	T	C	7: 103,843,031	E27G	probably damaging	Het
Hmcn1	A	T	1: 150,582,337	C5233S	probably damaging	Het
Hmgcr	C	T	13: 96,666,597	C30Y	probably damaging	Het
Hoxb6	A	G	11: 96,292,825		probably benign	Het
Igf2	T	C	7: 142,655,818	Q35R	possibly damaging	Het
Ighv1-4	C	T	12: 114,487,321	V56I	probably benign	Het
Kif13a	C	T	13: 46,752,455	V671M	possibly damaging	Het
Lmtk2	C	T	5: 144,174,360	Q633*	probably null	Het
Mesd	T	C	7: 83,895,749	Y136H	probably damaging	Het
Mga	T	A	2: 119,964,788	S2984R	possibly damaging	Het
Mkrn3	T	C	7: 62,418,927	N372S	probably benign	Het
Mtpap	A	G	18: 4,387,068	I373V	probably benign	Het
Mycbp2	G	A	14: 103,120,591	T4589M	probably damaging	Het
Myh2	A	G	11: 67,188,369	Q921R	probably benign	Het
Myom1	A	G	17: 71,045,549	D324G	possibly damaging	Het
Nat10	T	C	2: 103,754,169	K88E	probably benign	Het
Ncapd3	A	G	9: 27,069,958	R915G	probably damaging	Het
Nek4	T	C	14: 30,957,292	Y190H	probably damaging	Het
Nfasc	A	C	1: 132,602,052	Y797D	probably damaging	Het
Ngp	A	G	9: 110,420,910	D92G	probably benign	Het
Nos2	A	C	11: 78,929,854	H95P	probably damaging	Het
Nr3c1	ACGTC	ACGTCGTC	18: 39,486,460		probably benign	Het
Olfr1129	C	T	2: 87,575,519	T145I	probably benign	Het
Olfr1350	C	A	7: 6,570,716	H242N	probably damaging	Het
Olfr141	A	T	2: 86,806,623	H125Q	possibly damaging	Het
Olfr498	T	C	7: 108,465,435	I37T	possibly damaging	Het
Pdss1	T	A	2: 22,935,641		probably null	Het
Pex5	A	T	6: 124,398,063	L609*	probably null	Het
Pglyrp4	C	A	3: 90,732,974	A177D	probably damaging	Het
Phactr4	A	G	4: 132,377,178		probably null	Het
Pik3cd	G	C	4: 149,659,714	N193K	probably benign	Het
Prr36	TACCTCTTC	T	8: 4,215,163		probably benign	Het
Prss38	A	T	11: 59,375,558	W25R	probably benign	Het
Prss8	T	A	7: 127,926,884	Q189L	probably damaging	Het
Psd	T	A	19: 46,314,801	D713V	probably damaging	Het
Rad51ap2	C	T	12: 11,457,691	T538I	probably benign	Het
Rarres1	T	C	3: 67,515,184	T78A	probably benign	Het
Rbl2	G	T	8: 91,102,294	G651*	probably null	Het
Rev3l	A	T	10: 39,823,605	Q1366L	probably damaging	Het
Rundc1	T	C	11: 101,429,587	S215P	probably benign	Het
Scarf2	G	A	16: 17,802,973	W168*	probably null	Het
Sh2d7	A	G	9: 54,540,902	D69G	possibly damaging	Het
Slc26a4	A	T	12: 31,529,528	Y578*	probably null	Het
Slc2a9	A	T	5: 38,453,195	L87Q	probably damaging	Het
Slc39a10	A	T	1: 46,810,070	H795Q	probably damaging	Het
Spata13	C	T	14: 60,756,422	R1108W	probably damaging	Het
Sqle	T	C	15: 59,316,052	S70P	probably benign	Het
Syncrip	A	T	9: 88,464,663	F263I	probably damaging	Het
Synj2	T	C	17: 6,037,945	S1424P	possibly damaging	Het
Tax1bp3	A	T	11: 73,181,115	T89S	possibly damaging	Het
Tcaim	G	A	9: 122,819,027		probably null	Het
Tcp10c	T	C	17: 13,362,176	I240T	possibly damaging	Het
Ttll8	G	T	15: 88,917,239	N415K	probably benign	Het
Ugcg	T	C	4: 59,217,111	S212P	possibly damaging	Het
Vmn2r32	T	C	7: 7,479,808	K56E	probably benign	Het
Vmn2r55	T	C	7: 12,652,073	E660G	probably damaging	Het
Vmn2r7	T	C	3: 64,690,880	N752S	probably benign	Het
Vps54	T	A	11: 21,275,005	M167K	probably benign	Het
Vwa2	A	C	19: 56,909,359	M699L	probably benign	Het
Wdr59	A	G	8: 111,465,862	V689A		Het
Whamm	T	G	7: 81,586,247	N399K	probably damaging	Het
Zcchc6	T	C	13: 59,821,649	E144G	probably benign	Het
Zfp760	A	G	17: 21,722,779	K312E	probably benign	Het
Zkscan3	C	A	13: 21,394,813	V171L	probably benign	Het

Other mutations in Otogl

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
H8562:Otogl	UTSW	10	107910956	missense	probably benign	0.00
R0084:Otogl	UTSW	10	107901341	missense	probably damaging	0.96
R0164:Otogl	UTSW	10	107874530	missense	probably damaging	0.97
R0164:Otogl	UTSW	10	107874530	missense	probably damaging	0.97
R0238:Otogl	UTSW	10	107806696	missense	probably damaging	0.98
R0238:Otogl	UTSW	10	107806696	missense	probably damaging	0.98
R0239:Otogl	UTSW	10	107806696	missense	probably damaging	0.98
R0239:Otogl	UTSW	10	107806696	missense	probably damaging	0.98
R0294:Otogl	UTSW	10	107777228	missense	probably damaging	1.00
R0360:Otogl	UTSW	10	107770650	splice site	probably benign
R0442:Otogl	UTSW	10	107876855	missense	probably damaging	1.00
R0488:Otogl	UTSW	10	107803605	missense	probably benign	0.02
R0507:Otogl	UTSW	10	107866740	missense	possibly damaging	0.51
R0573:Otogl	UTSW	10	107780988	missense	probably benign	0.00
R0581:Otogl	UTSW	10	107789040	missense	possibly damaging	0.79
R0613:Otogl	UTSW	10	107817070	missense	probably damaging	0.99
R0614:Otogl	UTSW	10	107798355	missense	probably benign	0.14
R0742:Otogl	UTSW	10	107866740	missense	possibly damaging	0.51
R0846:Otogl	UTSW	10	107772296	missense	probably benign	0.40
R1146:Otogl	UTSW	10	107886513	missense	probably damaging	1.00
R1146:Otogl	UTSW	10	107886513	missense	probably damaging	1.00
R1439:Otogl	UTSW	10	107779252	missense	probably benign	0.02
R1457:Otogl	UTSW	10	107878152	splice site	probably null
R1526:Otogl	UTSW	10	107869526	missense	probably damaging	1.00
R1662:Otogl	UTSW	10	107798357	missense	possibly damaging	0.84
R1664:Otogl	UTSW	10	107806576	missense	probably benign	0.00
R1667:Otogl	UTSW	10	107813965	nonsense	probably null
R1695:Otogl	UTSW	10	107814017	missense	probably damaging	0.99
R1731:Otogl	UTSW	10	107817111	missense	probably damaging	1.00
R1733:Otogl	UTSW	10	107783712	missense	possibly damaging	0.46
R1764:Otogl	UTSW	10	107899461	nonsense	probably null
R1824:Otogl	UTSW	10	107779831	missense	probably benign
R1850:Otogl	UTSW	10	107878064	missense	probably damaging	1.00
R1856:Otogl	UTSW	10	107854264	missense	possibly damaging	0.92
R1875:Otogl	UTSW	10	107899590	missense	probably damaging	1.00
R1938:Otogl	UTSW	10	107777575	missense	probably damaging	0.98
R1986:Otogl	UTSW	10	107794190	critical splice acceptor site	probably null
R2072:Otogl	UTSW	10	107781043	missense	probably damaging	1.00
R2117:Otogl	UTSW	10	107858918	missense	probably benign	0.06
R2219:Otogl	UTSW	10	107856977	missense	probably damaging	1.00
R2508:Otogl	UTSW	10	107874500	missense	probably damaging	0.99
R2883:Otogl	UTSW	10	107768981	missense	probably damaging	1.00
R2931:Otogl	UTSW	10	107820004	missense	possibly damaging	0.85
R3620:Otogl	UTSW	10	107874371	missense	probably damaging	0.99
R3621:Otogl	UTSW	10	107874371	missense	probably damaging	0.99
R3735:Otogl	UTSW	10	107899529	nonsense	probably null
R3812:Otogl	UTSW	10	107899471	missense	probably damaging	1.00
R3880:Otogl	UTSW	10	107827704	missense	probably damaging	0.96
R3958:Otogl	UTSW	10	107821925	missense	probably damaging	1.00
R4063:Otogl	UTSW	10	107790649	missense	probably benign	0.02
R4064:Otogl	UTSW	10	107790649	missense	probably benign	0.02
R4108:Otogl	UTSW	10	107771244	missense	probably benign	0.01
R4352:Otogl	UTSW	10	107869535	missense	probably damaging	1.00
R4526:Otogl	UTSW	10	107886980	missense	probably damaging	1.00
R4614:Otogl	UTSW	10	107892124	nonsense	probably null
R4703:Otogl	UTSW	10	107821924	missense	probably damaging	1.00
R4741:Otogl	UTSW	10	107779260	missense	probably benign	0.00
R4790:Otogl	UTSW	10	107822033	critical splice acceptor site	probably null
R4801:Otogl	UTSW	10	107901336	missense	probably damaging	1.00
R4802:Otogl	UTSW	10	107901336	missense	probably damaging	1.00
R4910:Otogl	UTSW	10	107879517	missense	probably benign	0.05
R4913:Otogl	UTSW	10	107876855	missense	probably damaging	0.98
R5238:Otogl	UTSW	10	107768973	missense	probably damaging	1.00
R5261:Otogl	UTSW	10	107777592	missense	probably benign	0.16
R5387:Otogl	UTSW	10	107780933	missense	probably benign	0.03
R5395:Otogl	UTSW	10	107817138	missense	probably benign	0.39
R5403:Otogl	UTSW	10	107808756	missense	probably benign	0.08
R5482:Otogl	UTSW	10	107821941	missense	probably damaging	0.99
R5547:Otogl	UTSW	10	107782048	missense	possibly damaging	0.55
R5611:Otogl	UTSW	10	107786769	missense	probably damaging	1.00
R5642:Otogl	UTSW	10	107886552	missense	probably benign	0.44
R5690:Otogl	UTSW	10	107777117	synonymous	silent
R5711:Otogl	UTSW	10	107777117	synonymous	silent
R5731:Otogl	UTSW	10	107881464	missense	probably damaging	0.98
R5743:Otogl	UTSW	10	107857001	missense	possibly damaging	0.67
R5782:Otogl	UTSW	10	107777117	synonymous	silent
R5820:Otogl	UTSW	10	107777117	synonymous	silent
R5897:Otogl	UTSW	10	107777117	synonymous	silent
R6004:Otogl	UTSW	10	107879529	missense	probably damaging	1.00
R6145:Otogl	UTSW	10	107777117	synonymous	silent
R6146:Otogl	UTSW	10	107777117	synonymous	silent
R6147:Otogl	UTSW	10	107777117	synonymous	silent
R6149:Otogl	UTSW	10	107881453	missense	probably benign	0.36
R6226:Otogl	UTSW	10	107771206	nonsense	probably null
R6283:Otogl	UTSW	10	107790500	missense	probably damaging	0.98
R6414:Otogl	UTSW	10	107782050	missense	probably damaging	1.00
R6604:Otogl	UTSW	10	107822034	splice site	probably null
R6634:Otogl	UTSW	10	107862304	missense	probably damaging	1.00
R6727:Otogl	UTSW	10	107777117	synonymous	silent
R6755:Otogl	UTSW	10	107853303	nonsense	probably null
R6795:Otogl	UTSW	10	107777117	synonymous	silent
R6797:Otogl	UTSW	10	107777117	synonymous	silent
R6864:Otogl	UTSW	10	107827806	missense	probably damaging	0.96
R6924:Otogl	UTSW	10	107808641	missense	probably damaging	1.00
R6967:Otogl	UTSW	10	107814050	missense	probably benign	0.01
R7000:Otogl	UTSW	10	107779831	missense	probably benign
R7075:Otogl	UTSW	10	107778929	missense	probably benign	0.16
R7122:Otogl	UTSW	10	107866654	missense	probably benign	0.08
R7176:Otogl	UTSW	10	107778911	missense	probably damaging	1.00
R7184:Otogl	UTSW	10	107763200	missense	probably damaging	1.00
R7199:Otogl	UTSW	10	107874533	missense	possibly damaging	0.88
R7252:Otogl	UTSW	10	107821943	missense	probably benign	0.06
R7373:Otogl	UTSW	10	107901251	missense	probably damaging	1.00
R7449:Otogl	UTSW	10	107803663	missense	probably damaging	1.00
R7486:Otogl	UTSW	10	107821988	missense	probably damaging	1.00
R7493:Otogl	UTSW	10	107886982	missense	probably benign	0.06
R7659:Otogl	UTSW	10	107777120	missense	probably benign	0.19
R7732:Otogl	UTSW	10	107806664	missense	probably benign	0.01
R7754:Otogl	UTSW	10	107869546	missense	probably damaging	0.99
R7757:Otogl	UTSW	10	107876921	missense	probably damaging	1.00
R7800:Otogl	UTSW	10	107886515	missense	probably damaging	0.99
R7864:Otogl	UTSW	10	107869567	missense	probably damaging	1.00
R7879:Otogl	UTSW	10	107777109	missense	probably benign	0.00
R7941:Otogl	UTSW	10	107806802	splice site	probably null
R7956:Otogl	UTSW	10	107878026	missense	possibly damaging	0.62
R7988:Otogl	UTSW	10	107895776	missense	probably damaging	1.00
R8057:Otogl	UTSW	10	107808615	missense	probably benign	0.00
R8058:Otogl	UTSW	10	107762426	missense	probably damaging	1.00
R8127:Otogl	UTSW	10	107895752	missense	probably damaging	1.00
R8143:Otogl	UTSW	10	107806666	missense	probably damaging	1.00
R8310:Otogl	UTSW	10	107777600	missense	possibly damaging	0.94
R8319:Otogl	UTSW	10	107853266	critical splice donor site	probably null
R8339:Otogl	UTSW	10	107789535	missense	probably damaging	0.99
R8339:Otogl	UTSW	10	107789536	missense	probably benign	0.34
R8394:Otogl	UTSW	10	107886465	critical splice donor site	probably null
R8428:Otogl	UTSW	10	107798736	missense	probably damaging	1.00
R8444:Otogl	UTSW	10	107857114	missense	probably benign	0.01
R8501:Otogl	UTSW	10	107790560	missense	probably benign
R8503:Otogl	UTSW	10	107892126	missense	probably damaging	1.00
R8680:Otogl	UTSW	10	107912075	critical splice donor site	probably null
R9025:Otogl	UTSW	10	107777571	missense	probably damaging	0.99
R9090:Otogl	UTSW	10	107817113	missense	probably null	0.99
R9223:Otogl	UTSW	10	107854344	missense	probably damaging	0.99
R9268:Otogl	UTSW	10	107781056	missense	probably damaging	1.00
R9271:Otogl	UTSW	10	107817113	missense	probably null	0.99
R9356:Otogl	UTSW	10	107782029	missense	probably damaging	1.00
R9484:Otogl	UTSW	10	107822033	critical splice acceptor site	probably null
R9484:Otogl	UTSW	10	107901295	missense	probably damaging	1.00
R9571:Otogl	UTSW	10	107762503	missense	possibly damaging	0.94
R9731:Otogl	UTSW	10	107899467	missense	probably damaging	1.00
X0065:Otogl	UTSW	10	107895782	missense	probably damaging	1.00
X0067:Otogl	UTSW	10	107866677	missense	probably damaging	1.00
Z1176:Otogl	UTSW	10	107777213	missense	probably benign
Z1176:Otogl	UTSW	10	107778873	missense	probably damaging	0.97
Z1176:Otogl	UTSW	10	107789032	missense	probably benign	0.00
Z1177:Otogl	UTSW	10	107763258	nonsense	probably null
Z1177:Otogl	UTSW	10	107853397	missense	possibly damaging	0.78
Z1177:Otogl	UTSW	10	107876903	missense	probably benign	0.14

Predicted Primers

PCR Primer
(F):5'- TGTGGCAGATGACATTTTCTACTG -3'
(R):5'- TGCTTGATGAATGCCGACTG -3'

Sequencing Primer
(F):5'- CAGATGACATTTTCTACTGTGATTTG -3'
(R):5'- TGCCGACTGGTAGAGGCTAAC -3'

Posted On

2019-06-26