Incidental Mutation 'R7286:Glis2'
ID566052
Institutional Source Beutler Lab
Gene Symbol Glis2
Ensembl Gene ENSMUSG00000014303
Gene NameGLIS family zinc finger 2
SynonymsNkl
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.910) question?
Stock #R7286 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location4594713-4624924 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 4611318 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 128 (S128R)
Ref Sequence ENSEMBL: ENSMUSP00000014447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000014447] [ENSMUST00000141682]
Predicted Effect possibly damaging
Transcript: ENSMUST00000014447
AA Change: S128R

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000014447
Gene: ENSMUSG00000014303
AA Change: S128R

DomainStartEndE-ValueType
low complexity region 46 58 N/A INTRINSIC
low complexity region 74 100 N/A INTRINSIC
ZnF_C2H2 168 193 1.05e1 SMART
ZnF_C2H2 202 229 8.09e0 SMART
ZnF_C2H2 235 257 1.82e-3 SMART
ZnF_C2H2 263 287 3.16e-3 SMART
ZnF_C2H2 293 317 1.04e-3 SMART
low complexity region 328 342 N/A INTRINSIC
low complexity region 358 385 N/A INTRINSIC
low complexity region 387 402 N/A INTRINSIC
low complexity region 405 418 N/A INTRINSIC
low complexity region 420 445 N/A INTRINSIC
low complexity region 468 475 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141682
SMART Domains Protein: ENSMUSP00000115728
Gene: ENSMUSG00000014303

DomainStartEndE-ValueType
low complexity region 46 58 N/A INTRINSIC
low complexity region 74 100 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the GLI-similar zinc finger protein family and encodes a nuclear transcription factor with five C2H2-type zinc finger domains. The protein encoded by this gene is widely expressed at low levels in the neural tube and peripheral nervous system and likely promotes neuronal differentiation. It is abundantly expressed in the kidney and may have a role in the regulation of kidney morphogenesis. p120 regulates the expression level of this protein and induces the cleavage of this protein's C-terminal zinc finger domain. This protein also promotes the nuclear translocation of p120. Mutations in this gene cause nephronophthisis (NPHP), an autosomal recessive kidney disease characterized by tubular basement membrane disruption, interstitial lymphohistiocytic cell infiltration, and development of cysts at the corticomedullary border of the kidneys.[provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a fusion allele exhibit decreased kidney weight, kidney atrophy, kidney cysts, and interstitial fibrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,622,479 C130S probably benign Het
4921501E09Rik T C 17: 33,065,527 D767G probably benign Het
4930550C14Rik A T 9: 53,423,017 M187L possibly damaging Het
9930012K11Rik T C 14: 70,157,237 E156G possibly damaging Het
Acad9 C T 3: 36,075,990 A194V probably damaging Het
Agps T A 2: 75,852,784 V151E probably benign Het
Ak9 A T 10: 41,407,371 I1273L Het
Akr1c19 T A 13: 4,246,819 L288Q probably damaging Het
Carmil1 T G 13: 24,013,394 D1353A probably damaging Het
Ccz1 T A 5: 144,013,079 I43F probably damaging Het
Cep70 G A 9: 99,275,585 C179Y probably damaging Het
Comt A T 16: 18,410,690 L196H probably damaging Het
Cspg5 A T 9: 110,246,955 D253V probably damaging Het
Dars2 A G 1: 161,046,808 V437A possibly damaging Het
Dcaf5 A G 12: 80,348,390 I335T probably damaging Het
Ddn T C 15: 98,806,025 K462R possibly damaging Het
Dscaml1 T C 9: 45,742,746 probably null Het
Ethe1 A G 7: 24,607,952 Y197C probably damaging Het
Evc A T 5: 37,322,183 L269* probably null Het
Fam161a T C 11: 23,020,001 S60P possibly damaging Het
Fam20b A G 1: 156,681,442 V400A probably benign Het
Fam53b T A 7: 132,759,661 S213C possibly damaging Het
Flot2 A G 11: 78,054,786 I45V probably benign Het
Gemin4 A C 11: 76,212,753 L394R probably damaging Het
Gm3696 A G 14: 7,089,808 Y92H probably damaging Het
Gm49333 T C 16: 20,632,591 S325P probably benign Het
Gpbp1l1 T C 4: 116,590,245 V374A probably benign Het
Grm1 T C 10: 10,689,696 N956S probably benign Het
Hbb-bh1 T C 7: 103,843,031 E27G probably damaging Het
Hmcn1 A T 1: 150,582,337 C5233S probably damaging Het
Hmgcr C T 13: 96,666,597 C30Y probably damaging Het
Hoxb6 A G 11: 96,292,825 probably benign Het
Igf2 T C 7: 142,655,818 Q35R possibly damaging Het
Ighv1-4 C T 12: 114,487,321 V56I probably benign Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Lmtk2 C T 5: 144,174,360 Q633* probably null Het
Mesd T C 7: 83,895,749 Y136H probably damaging Het
Mga T A 2: 119,964,788 S2984R possibly damaging Het
Mkrn3 T C 7: 62,418,927 N372S probably benign Het
Mtpap A G 18: 4,387,068 I373V probably benign Het
Mycbp2 G A 14: 103,120,591 T4589M probably damaging Het
Myh2 A G 11: 67,188,369 Q921R probably benign Het
Myom1 A G 17: 71,045,549 D324G possibly damaging Het
Nat10 T C 2: 103,754,169 K88E probably benign Het
Ncapd3 A G 9: 27,069,958 R915G probably damaging Het
Nek4 T C 14: 30,957,292 Y190H probably damaging Het
Nfasc A C 1: 132,602,052 Y797D probably damaging Het
Ngp A G 9: 110,420,910 D92G probably benign Het
Nos2 A C 11: 78,929,854 H95P probably damaging Het
Nr3c1 ACGTC ACGTCGTC 18: 39,486,460 probably benign Het
Olfr1129 C T 2: 87,575,519 T145I probably benign Het
Olfr1350 C A 7: 6,570,716 H242N probably damaging Het
Olfr141 A T 2: 86,806,623 H125Q possibly damaging Het
Olfr498 T C 7: 108,465,435 I37T possibly damaging Het
Otogl T A 10: 107,770,610 D2154V probably benign Het
Pdss1 T A 2: 22,935,641 probably null Het
Pex5 A T 6: 124,398,063 L609* probably null Het
Pglyrp4 C A 3: 90,732,974 A177D probably damaging Het
Phactr4 A G 4: 132,377,178 probably null Het
Pik3cd G C 4: 149,659,714 N193K probably benign Het
Prr36 TACCTCTTC T 8: 4,215,163 probably benign Het
Prss38 A T 11: 59,375,558 W25R probably benign Het
Prss8 T A 7: 127,926,884 Q189L probably damaging Het
Psd T A 19: 46,314,801 D713V probably damaging Het
Rad51ap2 C T 12: 11,457,691 T538I probably benign Het
Rarres1 T C 3: 67,515,184 T78A probably benign Het
Rbl2 G T 8: 91,102,294 G651* probably null Het
Rev3l A T 10: 39,823,605 Q1366L probably damaging Het
Rundc1 T C 11: 101,429,587 S215P probably benign Het
Scarf2 G A 16: 17,802,973 W168* probably null Het
Sh2d7 A G 9: 54,540,902 D69G possibly damaging Het
Slc26a4 A T 12: 31,529,528 Y578* probably null Het
Slc2a9 A T 5: 38,453,195 L87Q probably damaging Het
Slc39a10 A T 1: 46,810,070 H795Q probably damaging Het
Spata13 C T 14: 60,756,422 R1108W probably damaging Het
Sqle T C 15: 59,316,052 S70P probably benign Het
Syncrip A T 9: 88,464,663 F263I probably damaging Het
Synj2 T C 17: 6,037,945 S1424P possibly damaging Het
Tax1bp3 A T 11: 73,181,115 T89S possibly damaging Het
Tcaim G A 9: 122,819,027 probably null Het
Tcp10c T C 17: 13,362,176 I240T possibly damaging Het
Ttll8 G T 15: 88,917,239 N415K probably benign Het
Ugcg T C 4: 59,217,111 S212P possibly damaging Het
Vmn2r32 T C 7: 7,479,808 K56E probably benign Het
Vmn2r55 T C 7: 12,652,073 E660G probably damaging Het
Vmn2r7 T C 3: 64,690,880 N752S probably benign Het
Vps54 T A 11: 21,275,005 M167K probably benign Het
Vwa2 A C 19: 56,909,359 M699L probably benign Het
Wdr59 A G 8: 111,465,862 V689A Het
Whamm T G 7: 81,586,247 N399K probably damaging Het
Zcchc6 T C 13: 59,821,649 E144G probably benign Het
Zfp760 A G 17: 21,722,779 K312E probably benign Het
Zkscan3 C A 13: 21,394,813 V171L probably benign Het
Other mutations in Glis2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01023:Glis2 APN 16 4611650 missense probably damaging 1.00
IGL01680:Glis2 APN 16 4611331 missense possibly damaging 0.82
IGL02055:Glis2 APN 16 4614108 unclassified probably benign
IGL02802:Glis2 UTSW 16 4611871 critical splice donor site probably null
R0081:Glis2 UTSW 16 4613653 missense probably benign 0.22
R0517:Glis2 UTSW 16 4611552 missense probably damaging 0.98
R2010:Glis2 UTSW 16 4608711 missense probably damaging 0.99
R2145:Glis2 UTSW 16 4613642 missense possibly damaging 0.79
R3780:Glis2 UTSW 16 4613896 unclassified probably benign
R4180:Glis2 UTSW 16 4611376 missense probably benign 0.04
R5213:Glis2 UTSW 16 4614082 unclassified probably benign
R6012:Glis2 UTSW 16 4611308 missense possibly damaging 0.76
R6052:Glis2 UTSW 16 4613739 unclassified probably benign
R6214:Glis2 UTSW 16 4610333 nonsense probably null
R6215:Glis2 UTSW 16 4610333 nonsense probably null
R6316:Glis2 UTSW 16 4613836 unclassified probably benign
R7172:Glis2 UTSW 16 4613475 missense probably benign 0.32
R7346:Glis2 UTSW 16 4613568 missense possibly damaging 0.83
R7816:Glis2 UTSW 16 4613464 missense probably damaging 1.00
X0020:Glis2 UTSW 16 4608653 missense probably damaging 1.00
X0027:Glis2 UTSW 16 4611457 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GCCTTTGCCTTTCAAGTGCTAG -3'
(R):5'- AAAGAGCTGGTTACACTGTGGG -3'

Sequencing Primer
(F):5'- CCTTTCAAGTGCTAGGATTTAAAGGC -3'
(R):5'- CAGGGTTCTGAGCCCAAGTAG -3'
Posted On2019-06-26