Mutagenetix > Incidental Mutation

Incidental Mutation 'R7286:Glis2'

566052

Institutional Source

Beutler Lab

Gene Symbol

Glis2

Ensembl Gene

ENSMUSG00000014303

Gene Name

GLIS family zinc finger 2

Synonyms

Nkl

MMRRC Submission

Accession Numbers

Essential gene?

Probably essential (E-score: 0.915) question?

Stock #

R7286 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

4594713-4624924 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 4611318 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 128 (S128R)

Ref Sequence

ENSEMBL: ENSMUSP00000014447 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000014447] [ENSMUST00000141682]

AlphaFold

Q8VDL9

Predicted Effect

possibly damaging
Transcript: ENSMUST00000014447
AA Change: S128R

PolyPhen 2 Score 0.928 (Sensitivity: 0.81; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000014447
Gene: ENSMUSG00000014303
AA Change: S128R

Domain	Start	End	E-Value	Type
low complexity region	46	58	N/A	INTRINSIC
low complexity region	74	100	N/A	INTRINSIC
ZnF_C2H2	168	193	1.05e1	SMART
ZnF_C2H2	202	229	8.09e0	SMART
ZnF_C2H2	235	257	1.82e-3	SMART
ZnF_C2H2	263	287	3.16e-3	SMART
ZnF_C2H2	293	317	1.04e-3	SMART
low complexity region	328	342	N/A	INTRINSIC
low complexity region	358	385	N/A	INTRINSIC
low complexity region	387	402	N/A	INTRINSIC
low complexity region	405	418	N/A	INTRINSIC
low complexity region	420	445	N/A	INTRINSIC
low complexity region	468	475	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000141682

SMART Domains

Protein: ENSMUSP00000115728
Gene: ENSMUSG00000014303

Domain	Start	End	E-Value	Type
low complexity region	46	58	N/A	INTRINSIC
low complexity region	74	100	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the GLI-similar zinc finger protein family and encodes a nuclear transcription factor with five C2H2-type zinc finger domains. The protein encoded by this gene is widely expressed at low levels in the neural tube and peripheral nervous system and likely promotes neuronal differentiation. It is abundantly expressed in the kidney and may have a role in the regulation of kidney morphogenesis. p120 regulates the expression level of this protein and induces the cleavage of this protein's C-terminal zinc finger domain. This protein also promotes the nuclear translocation of p120. Mutations in this gene cause nephronophthisis (NPHP), an autosomal recessive kidney disease characterized by tubular basement membrane disruption, interstitial lymphohistiocytic cell infiltration, and development of cysts at the corticomedullary border of the kidneys.[provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a fusion allele exhibit decreased kidney weight, kidney atrophy, kidney cysts, and interstitial fibrosis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 93 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
0610010F05Rik	A	T	11: 23,622,479	C130S	probably benign	Het
4921501E09Rik	T	C	17: 33,065,527	D767G	probably benign	Het
4930550C14Rik	A	T	9: 53,423,017	M187L	possibly damaging	Het
9930012K11Rik	T	C	14: 70,157,237	E156G	possibly damaging	Het
Acad9	C	T	3: 36,075,990	A194V	probably damaging	Het
Agps	T	A	2: 75,852,784	V151E	probably benign	Het
Ak9	A	T	10: 41,407,371	I1273L		Het
Akr1c19	T	A	13: 4,246,819	L288Q	probably damaging	Het
Carmil1	T	G	13: 24,013,394	D1353A	probably damaging	Het
Ccz1	T	A	5: 144,013,079	I43F	probably damaging	Het
Cep70	G	A	9: 99,275,585	C179Y	probably damaging	Het
Comt	A	T	16: 18,410,690	L196H	probably damaging	Het
Cspg5	A	T	9: 110,246,955	D253V	probably damaging	Het
Dars2	A	G	1: 161,046,808	V437A	possibly damaging	Het
Dcaf5	A	G	12: 80,348,390	I335T	probably damaging	Het
Ddn	T	C	15: 98,806,025	K462R	possibly damaging	Het
Dscaml1	T	C	9: 45,742,746		probably null	Het
Ethe1	A	G	7: 24,607,952	Y197C	probably damaging	Het
Evc	A	T	5: 37,322,183	L269*	probably null	Het
Fam161a	T	C	11: 23,020,001	S60P	possibly damaging	Het
Fam20b	A	G	1: 156,681,442	V400A	probably benign	Het
Fam53b	T	A	7: 132,759,661	S213C	possibly damaging	Het
Flot2	A	G	11: 78,054,786	I45V	probably benign	Het
Gemin4	A	C	11: 76,212,753	L394R	probably damaging	Het
Gm3696	A	G	14: 7,089,808	Y92H	probably damaging	Het
Gm49333	T	C	16: 20,632,591	S325P	probably benign	Het
Gpbp1l1	T	C	4: 116,590,245	V374A	probably benign	Het
Grm1	T	C	10: 10,689,696	N956S	probably benign	Het
Hbb-bh1	T	C	7: 103,843,031	E27G	probably damaging	Het
Hmcn1	A	T	1: 150,582,337	C5233S	probably damaging	Het
Hmgcr	C	T	13: 96,666,597	C30Y	probably damaging	Het
Hoxb6	A	G	11: 96,292,825		probably benign	Het
Igf2	T	C	7: 142,655,818	Q35R	possibly damaging	Het
Ighv1-4	C	T	12: 114,487,321	V56I	probably benign	Het
Kif13a	C	T	13: 46,752,455	V671M	possibly damaging	Het
Lmtk2	C	T	5: 144,174,360	Q633*	probably null	Het
Mesd	T	C	7: 83,895,749	Y136H	probably damaging	Het
Mga	T	A	2: 119,964,788	S2984R	possibly damaging	Het
Mkrn3	T	C	7: 62,418,927	N372S	probably benign	Het
Mtpap	A	G	18: 4,387,068	I373V	probably benign	Het
Mycbp2	G	A	14: 103,120,591	T4589M	probably damaging	Het
Myh2	A	G	11: 67,188,369	Q921R	probably benign	Het
Myom1	A	G	17: 71,045,549	D324G	possibly damaging	Het
Nat10	T	C	2: 103,754,169	K88E	probably benign	Het
Ncapd3	A	G	9: 27,069,958	R915G	probably damaging	Het
Nek4	T	C	14: 30,957,292	Y190H	probably damaging	Het
Nfasc	A	C	1: 132,602,052	Y797D	probably damaging	Het
Ngp	A	G	9: 110,420,910	D92G	probably benign	Het
Nos2	A	C	11: 78,929,854	H95P	probably damaging	Het
Nr3c1	ACGTC	ACGTCGTC	18: 39,486,460		probably benign	Het
Olfr1129	C	T	2: 87,575,519	T145I	probably benign	Het
Olfr1350	C	A	7: 6,570,716	H242N	probably damaging	Het
Olfr141	A	T	2: 86,806,623	H125Q	possibly damaging	Het
Olfr498	T	C	7: 108,465,435	I37T	possibly damaging	Het
Otogl	T	A	10: 107,770,610	D2154V	probably benign	Het
Pdss1	T	A	2: 22,935,641		probably null	Het
Pex5	A	T	6: 124,398,063	L609*	probably null	Het
Pglyrp4	C	A	3: 90,732,974	A177D	probably damaging	Het
Phactr4	A	G	4: 132,377,178		probably null	Het
Pik3cd	G	C	4: 149,659,714	N193K	probably benign	Het
Prr36	TACCTCTTC	T	8: 4,215,163		probably benign	Het
Prss38	A	T	11: 59,375,558	W25R	probably benign	Het
Prss8	T	A	7: 127,926,884	Q189L	probably damaging	Het
Psd	T	A	19: 46,314,801	D713V	probably damaging	Het
Rad51ap2	C	T	12: 11,457,691	T538I	probably benign	Het
Rarres1	T	C	3: 67,515,184	T78A	probably benign	Het
Rbl2	G	T	8: 91,102,294	G651*	probably null	Het
Rev3l	A	T	10: 39,823,605	Q1366L	probably damaging	Het
Rundc1	T	C	11: 101,429,587	S215P	probably benign	Het
Scarf2	G	A	16: 17,802,973	W168*	probably null	Het
Sh2d7	A	G	9: 54,540,902	D69G	possibly damaging	Het
Slc26a4	A	T	12: 31,529,528	Y578*	probably null	Het
Slc2a9	A	T	5: 38,453,195	L87Q	probably damaging	Het
Slc39a10	A	T	1: 46,810,070	H795Q	probably damaging	Het
Spata13	C	T	14: 60,756,422	R1108W	probably damaging	Het
Sqle	T	C	15: 59,316,052	S70P	probably benign	Het
Syncrip	A	T	9: 88,464,663	F263I	probably damaging	Het
Synj2	T	C	17: 6,037,945	S1424P	possibly damaging	Het
Tax1bp3	A	T	11: 73,181,115	T89S	possibly damaging	Het
Tcaim	G	A	9: 122,819,027		probably null	Het
Tcp10c	T	C	17: 13,362,176	I240T	possibly damaging	Het
Ttll8	G	T	15: 88,917,239	N415K	probably benign	Het
Ugcg	T	C	4: 59,217,111	S212P	possibly damaging	Het
Vmn2r32	T	C	7: 7,479,808	K56E	probably benign	Het
Vmn2r55	T	C	7: 12,652,073	E660G	probably damaging	Het
Vmn2r7	T	C	3: 64,690,880	N752S	probably benign	Het
Vps54	T	A	11: 21,275,005	M167K	probably benign	Het
Vwa2	A	C	19: 56,909,359	M699L	probably benign	Het
Wdr59	A	G	8: 111,465,862	V689A		Het
Whamm	T	G	7: 81,586,247	N399K	probably damaging	Het
Zcchc6	T	C	13: 59,821,649	E144G	probably benign	Het
Zfp760	A	G	17: 21,722,779	K312E	probably benign	Het
Zkscan3	C	A	13: 21,394,813	V171L	probably benign	Het

Other mutations in Glis2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01023:Glis2	APN	16	4611650	missense	probably damaging	1.00
IGL01680:Glis2	APN	16	4611331	missense	possibly damaging	0.82
IGL02055:Glis2	APN	16	4614108	unclassified	probably benign
Ginsburg	UTSW	16	4610333	nonsense	probably null
IGL02802:Glis2	UTSW	16	4611871	critical splice donor site	probably null
R0081:Glis2	UTSW	16	4613653	missense	probably benign	0.22
R0517:Glis2	UTSW	16	4611552	missense	probably damaging	0.98
R2010:Glis2	UTSW	16	4608711	missense	probably damaging	0.99
R2145:Glis2	UTSW	16	4613642	missense	possibly damaging	0.79
R3780:Glis2	UTSW	16	4613896	unclassified	probably benign
R4180:Glis2	UTSW	16	4611376	missense	probably benign	0.04
R5213:Glis2	UTSW	16	4614082	unclassified	probably benign
R6012:Glis2	UTSW	16	4611308	missense	possibly damaging	0.76
R6052:Glis2	UTSW	16	4613739	unclassified	probably benign
R6214:Glis2	UTSW	16	4610333	nonsense	probably null
R6215:Glis2	UTSW	16	4610333	nonsense	probably null
R6316:Glis2	UTSW	16	4613836	unclassified	probably benign
R7172:Glis2	UTSW	16	4613475	missense	probably benign	0.32
R7346:Glis2	UTSW	16	4613568	missense	possibly damaging	0.83
R7816:Glis2	UTSW	16	4613464	missense	probably damaging	1.00
R9097:Glis2	UTSW	16	4611776	missense	probably damaging	0.99
R9573:Glis2	UTSW	16	4611641	missense	probably damaging	1.00
X0020:Glis2	UTSW	16	4608653	missense	probably damaging	1.00
X0027:Glis2	UTSW	16	4611457	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GCCTTTGCCTTTCAAGTGCTAG -3'
(R):5'- AAAGAGCTGGTTACACTGTGGG -3'

Sequencing Primer
(F):5'- CCTTTCAAGTGCTAGGATTTAAAGGC -3'
(R):5'- CAGGGTTCTGAGCCCAAGTAG -3'

Posted On

2019-06-26