Incidental Mutation 'R7286:Synj2'
ID566056
Institutional Source Beutler Lab
Gene Symbol Synj2
Ensembl Gene ENSMUSG00000023805
Gene Namesynaptojanin 2
SynonymsSJ2
MMRRC Submission
Accession Numbers

Genbank: NM_001113353.1, NM_001113352.1, NM_011523.2, NM_001113351.1

Is this an essential gene? Probably non essential (E-score: 0.179) question?
Stock #R7286 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location5941280-6044290 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 6037945 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 1424 (S1424P)
Ref Sequence ENSEMBL: ENSMUSP00000111457 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061091] [ENSMUST00000080283] [ENSMUST00000097432] [ENSMUST00000115785] [ENSMUST00000115790] [ENSMUST00000115791] [ENSMUST00000126881] [ENSMUST00000134767] [ENSMUST00000154114]
Predicted Effect probably benign
Transcript: ENSMUST00000061091
SMART Domains Protein: ENSMUSP00000060382
Gene: ENSMUSG00000023805

DomainStartEndE-ValueType
Pfam:Syja_N 1 263 2.5e-72 PFAM
Blast:IPPc 394 423 3e-6 BLAST
IPPc 443 785 3.72e-128 SMART
DUF1866 778 923 1.04e-73 SMART
low complexity region 926 940 N/A INTRINSIC
low complexity region 965 976 N/A INTRINSIC
low complexity region 1012 1027 N/A INTRINSIC
low complexity region 1127 1139 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000080283
AA Change: S1379P

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000079164
Gene: ENSMUSG00000023805
AA Change: S1379P

DomainStartEndE-ValueType
Pfam:Syja_N 60 348 5.5e-78 PFAM
Blast:IPPc 479 508 3e-6 BLAST
IPPc 528 870 3.72e-128 SMART
DUF1866 863 1008 1.04e-73 SMART
low complexity region 1011 1025 N/A INTRINSIC
low complexity region 1050 1061 N/A INTRINSIC
low complexity region 1167 1179 N/A INTRINSIC
low complexity region 1217 1234 N/A INTRINSIC
low complexity region 1263 1277 N/A INTRINSIC
low complexity region 1293 1306 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000097432
SMART Domains Protein: ENSMUSP00000095043
Gene: ENSMUSG00000015659

DomainStartEndE-ValueType
transmembrane domain 32 54 N/A INTRINSIC
SCOP:d1gw5a_ 89 464 3e-6 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000115785
AA Change: S1063P

PolyPhen 2 Score 0.868 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000111451
Gene: ENSMUSG00000023805
AA Change: S1063P

DomainStartEndE-ValueType
PDB:3LWT|X 9 171 4e-12 PDB
Blast:IPPc 163 192 2e-6 BLAST
IPPc 212 554 3.72e-128 SMART
DUF1866 547 692 1.04e-73 SMART
low complexity region 695 709 N/A INTRINSIC
low complexity region 734 745 N/A INTRINSIC
low complexity region 851 863 N/A INTRINSIC
low complexity region 901 918 N/A INTRINSIC
low complexity region 947 961 N/A INTRINSIC
low complexity region 977 990 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115790
AA Change: S1339P

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000111456
Gene: ENSMUSG00000023805
AA Change: S1339P

DomainStartEndE-ValueType
Pfam:Syja_N 1 263 3e-72 PFAM
Blast:IPPc 394 423 3e-6 BLAST
IPPc 443 785 3.72e-128 SMART
DUF1866 778 923 1.04e-73 SMART
low complexity region 926 940 N/A INTRINSIC
low complexity region 965 976 N/A INTRINSIC
low complexity region 1012 1027 N/A INTRINSIC
low complexity region 1127 1139 N/A INTRINSIC
low complexity region 1177 1194 N/A INTRINSIC
low complexity region 1223 1237 N/A INTRINSIC
low complexity region 1253 1266 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000115791
AA Change: S1424P

PolyPhen 2 Score 0.787 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000111457
Gene: ENSMUSG00000023805
AA Change: S1424P

DomainStartEndE-ValueType
Pfam:Syja_N 61 343 8.5e-67 PFAM
Blast:IPPc 479 508 3e-6 BLAST
IPPc 528 870 3.72e-128 SMART
DUF1866 863 1008 1.04e-73 SMART
low complexity region 1011 1025 N/A INTRINSIC
low complexity region 1050 1061 N/A INTRINSIC
low complexity region 1097 1112 N/A INTRINSIC
low complexity region 1212 1224 N/A INTRINSIC
low complexity region 1262 1279 N/A INTRINSIC
low complexity region 1308 1322 N/A INTRINSIC
low complexity region 1338 1351 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126881
SMART Domains Protein: ENSMUSP00000115371
Gene: ENSMUSG00000023805

DomainStartEndE-ValueType
DUF1866 16 161 1.04e-73 SMART
low complexity region 164 178 N/A INTRINSIC
low complexity region 203 214 N/A INTRINSIC
low complexity region 320 332 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000134767
Predicted Effect probably benign
Transcript: ENSMUST00000154114
SMART Domains Protein: ENSMUSP00000122316
Gene: ENSMUSG00000023805

DomainStartEndE-ValueType
IPPc 6 348 3.72e-128 SMART
DUF1866 341 486 1.04e-73 SMART
low complexity region 489 503 N/A INTRINSIC
low complexity region 528 539 N/A INTRINSIC
low complexity region 645 657 N/A INTRINSIC
low complexity region 678 694 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The gene is a member of the inositol-polyphosphate 5-phosphatase family. The encoded protein interacts with the ras-related C3 botulinum toxin substrate 1, which causes translocation of the encoded protein to the plasma membrane where it inhibits clathrin-mediated endocytosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygotes for an ENU-induced allele show progressive hearing loss and cochlear hair cell degeneration associated with fusion of stereocilia followed by total loss of hair bundles and cochlear ganglion degeneration. No vestibular dysfunction or other behavioral deficits are observed. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted, other(1) Gene trapped(4)

Other mutations in this stock
Total: 93 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
0610010F05Rik A T 11: 23,622,479 C130S probably benign Het
4921501E09Rik T C 17: 33,065,527 D767G probably benign Het
4930550C14Rik A T 9: 53,423,017 M187L possibly damaging Het
9930012K11Rik T C 14: 70,157,237 E156G possibly damaging Het
Acad9 C T 3: 36,075,990 A194V probably damaging Het
Agps T A 2: 75,852,784 V151E probably benign Het
Ak9 A T 10: 41,407,371 I1273L Het
Akr1c19 T A 13: 4,246,819 L288Q probably damaging Het
Carmil1 T G 13: 24,013,394 D1353A probably damaging Het
Ccz1 T A 5: 144,013,079 I43F probably damaging Het
Cep70 G A 9: 99,275,585 C179Y probably damaging Het
Comt A T 16: 18,410,690 L196H probably damaging Het
Cspg5 A T 9: 110,246,955 D253V probably damaging Het
Dars2 A G 1: 161,046,808 V437A possibly damaging Het
Dcaf5 A G 12: 80,348,390 I335T probably damaging Het
Ddn T C 15: 98,806,025 K462R possibly damaging Het
Dscaml1 T C 9: 45,742,746 probably null Het
Ethe1 A G 7: 24,607,952 Y197C probably damaging Het
Evc A T 5: 37,322,183 L269* probably null Het
Fam161a T C 11: 23,020,001 S60P possibly damaging Het
Fam20b A G 1: 156,681,442 V400A probably benign Het
Fam53b T A 7: 132,759,661 S213C possibly damaging Het
Flot2 A G 11: 78,054,786 I45V probably benign Het
Gemin4 A C 11: 76,212,753 L394R probably damaging Het
Glis2 T G 16: 4,611,318 S128R possibly damaging Het
Gm3696 A G 14: 7,089,808 Y92H probably damaging Het
Gm49333 T C 16: 20,632,591 S325P probably benign Het
Gpbp1l1 T C 4: 116,590,245 V374A probably benign Het
Grm1 T C 10: 10,689,696 N956S probably benign Het
Hbb-bh1 T C 7: 103,843,031 E27G probably damaging Het
Hmcn1 A T 1: 150,582,337 C5233S probably damaging Het
Hmgcr C T 13: 96,666,597 C30Y probably damaging Het
Hoxb6 A G 11: 96,292,825 probably benign Het
Igf2 T C 7: 142,655,818 Q35R possibly damaging Het
Ighv1-4 C T 12: 114,487,321 V56I probably benign Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Lmtk2 C T 5: 144,174,360 Q633* probably null Het
Mesd T C 7: 83,895,749 Y136H probably damaging Het
Mga T A 2: 119,964,788 S2984R possibly damaging Het
Mkrn3 T C 7: 62,418,927 N372S probably benign Het
Mtpap A G 18: 4,387,068 I373V probably benign Het
Mycbp2 G A 14: 103,120,591 T4589M probably damaging Het
Myh2 A G 11: 67,188,369 Q921R probably benign Het
Myom1 A G 17: 71,045,549 D324G possibly damaging Het
Nat10 T C 2: 103,754,169 K88E probably benign Het
Ncapd3 A G 9: 27,069,958 R915G probably damaging Het
Nek4 T C 14: 30,957,292 Y190H probably damaging Het
Nfasc A C 1: 132,602,052 Y797D probably damaging Het
Ngp A G 9: 110,420,910 D92G probably benign Het
Nos2 A C 11: 78,929,854 H95P probably damaging Het
Nr3c1 ACGTC ACGTCGTC 18: 39,486,460 probably benign Het
Olfr1129 C T 2: 87,575,519 T145I probably benign Het
Olfr1350 C A 7: 6,570,716 H242N probably damaging Het
Olfr141 A T 2: 86,806,623 H125Q possibly damaging Het
Olfr498 T C 7: 108,465,435 I37T possibly damaging Het
Otogl T A 10: 107,770,610 D2154V probably benign Het
Pdss1 T A 2: 22,935,641 probably null Het
Pex5 A T 6: 124,398,063 L609* probably null Het
Pglyrp4 C A 3: 90,732,974 A177D probably damaging Het
Phactr4 A G 4: 132,377,178 probably null Het
Pik3cd G C 4: 149,659,714 N193K probably benign Het
Prr36 TACCTCTTC T 8: 4,215,163 probably benign Het
Prss38 A T 11: 59,375,558 W25R probably benign Het
Prss8 T A 7: 127,926,884 Q189L probably damaging Het
Psd T A 19: 46,314,801 D713V probably damaging Het
Rad51ap2 C T 12: 11,457,691 T538I probably benign Het
Rarres1 T C 3: 67,515,184 T78A probably benign Het
Rbl2 G T 8: 91,102,294 G651* probably null Het
Rev3l A T 10: 39,823,605 Q1366L probably damaging Het
Rundc1 T C 11: 101,429,587 S215P probably benign Het
Scarf2 G A 16: 17,802,973 W168* probably null Het
Sh2d7 A G 9: 54,540,902 D69G possibly damaging Het
Slc26a4 A T 12: 31,529,528 Y578* probably null Het
Slc2a9 A T 5: 38,453,195 L87Q probably damaging Het
Slc39a10 A T 1: 46,810,070 H795Q probably damaging Het
Spata13 C T 14: 60,756,422 R1108W probably damaging Het
Sqle T C 15: 59,316,052 S70P probably benign Het
Syncrip A T 9: 88,464,663 F263I probably damaging Het
Tax1bp3 A T 11: 73,181,115 T89S possibly damaging Het
Tcaim G A 9: 122,819,027 probably null Het
Tcp10c T C 17: 13,362,176 I240T possibly damaging Het
Ttll8 G T 15: 88,917,239 N415K probably benign Het
Ugcg T C 4: 59,217,111 S212P possibly damaging Het
Vmn2r32 T C 7: 7,479,808 K56E probably benign Het
Vmn2r55 T C 7: 12,652,073 E660G probably damaging Het
Vmn2r7 T C 3: 64,690,880 N752S probably benign Het
Vps54 T A 11: 21,275,005 M167K probably benign Het
Vwa2 A C 19: 56,909,359 M699L probably benign Het
Wdr59 A G 8: 111,465,862 V689A Het
Whamm T G 7: 81,586,247 N399K probably damaging Het
Zcchc6 T C 13: 59,821,649 E144G probably benign Het
Zfp760 A G 17: 21,722,779 K312E probably benign Het
Zkscan3 C A 13: 21,394,813 V171L probably benign Het
Other mutations in Synj2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Synj2 APN 17 6037926 missense possibly damaging 0.48
IGL01399:Synj2 APN 17 6009771 missense probably damaging 1.00
IGL01793:Synj2 APN 17 6027225 nonsense probably null
IGL01793:Synj2 APN 17 6038046 missense probably benign 0.01
IGL02096:Synj2 APN 17 5990353 missense probably damaging 1.00
IGL02115:Synj2 APN 17 6017590 missense probably damaging 1.00
IGL02222:Synj2 APN 17 6037480 missense probably benign 0.04
IGL02478:Synj2 APN 17 6037924 missense probably benign 0.00
IGL02634:Synj2 APN 17 6029760 missense probably damaging 1.00
IGL02652:Synj2 APN 17 6017593 missense probably damaging 1.00
IGL02681:Synj2 APN 17 5990336 missense probably damaging 1.00
IGL02719:Synj2 APN 17 5996917 missense probably benign 0.02
IGL03253:Synj2 APN 17 6003159 splice site probably null
IGL03365:Synj2 APN 17 6019404 missense probably damaging 1.00
I2288:Synj2 UTSW 17 6022267 splice site probably benign
I2289:Synj2 UTSW 17 6022267 splice site probably benign
R0389:Synj2 UTSW 17 6029783 missense probably benign 0.35
R0433:Synj2 UTSW 17 6033848 missense probably damaging 1.00
R0530:Synj2 UTSW 17 6008105 missense possibly damaging 0.88
R0539:Synj2 UTSW 17 5996888 start codon destroyed probably null 0.63
R0556:Synj2 UTSW 17 6037955 nonsense probably null
R1263:Synj2 UTSW 17 6019359 missense probably damaging 0.99
R1443:Synj2 UTSW 17 6023665 missense probably damaging 0.99
R1450:Synj2 UTSW 17 6027324 splice site probably benign
R1532:Synj2 UTSW 17 6033919 missense probably benign 0.00
R1542:Synj2 UTSW 17 6025017 missense probably benign 0.01
R1809:Synj2 UTSW 17 6026551 missense possibly damaging 0.95
R1875:Synj2 UTSW 17 6028550 missense possibly damaging 0.69
R1897:Synj2 UTSW 17 6022137 nonsense probably null
R1928:Synj2 UTSW 17 5990267 missense probably damaging 0.99
R2008:Synj2 UTSW 17 5996946 missense probably damaging 1.00
R2060:Synj2 UTSW 17 6037480 missense probably benign 0.04
R2109:Synj2 UTSW 17 6013691 missense probably benign 0.00
R2332:Synj2 UTSW 17 6023794 missense probably damaging 0.99
R2413:Synj2 UTSW 17 6028574 missense probably damaging 1.00
R3684:Synj2 UTSW 17 6028443 missense probably damaging 0.97
R4111:Synj2 UTSW 17 6007965 missense probably benign 0.02
R4113:Synj2 UTSW 17 6007965 missense probably benign 0.02
R4654:Synj2 UTSW 17 6013538 missense probably damaging 1.00
R4797:Synj2 UTSW 17 6033888 missense probably damaging 1.00
R4812:Synj2 UTSW 17 6010664 missense probably damaging 1.00
R4873:Synj2 UTSW 17 5988068 intron probably benign
R4875:Synj2 UTSW 17 5988068 intron probably benign
R5110:Synj2 UTSW 17 6037715 missense probably benign 0.06
R5205:Synj2 UTSW 17 5941518 missense probably damaging 1.00
R5504:Synj2 UTSW 17 6036475 missense possibly damaging 0.85
R5593:Synj2 UTSW 17 6038115 makesense probably null
R5690:Synj2 UTSW 17 6035527 missense probably benign 0.00
R5870:Synj2 UTSW 17 6037853 missense probably benign 0.00
R6084:Synj2 UTSW 17 6017614 missense probably damaging 0.98
R6084:Synj2 UTSW 17 6038098 missense probably damaging 1.00
R6158:Synj2 UTSW 17 5986212 missense probably benign 0.00
R6159:Synj2 UTSW 17 5986052 missense probably damaging 1.00
R6160:Synj2 UTSW 17 6008061 missense possibly damaging 0.92
R6278:Synj2 UTSW 17 5975874 missense probably damaging 1.00
R6406:Synj2 UTSW 17 6019571 intron probably benign
R6531:Synj2 UTSW 17 6033839 missense probably damaging 1.00
R6729:Synj2 UTSW 17 5986014 start codon destroyed probably null 1.00
R6774:Synj2 UTSW 17 6038015 missense possibly damaging 0.87
R6792:Synj2 UTSW 17 5990290 missense probably benign 0.01
R6844:Synj2 UTSW 17 5975806 missense probably damaging 0.96
R6865:Synj2 UTSW 17 6017569 nonsense probably null
R7178:Synj2 UTSW 17 6026479 missense possibly damaging 0.95
R7403:Synj2 UTSW 17 6037730 missense possibly damaging 0.76
R7451:Synj2 UTSW 17 6029791 missense possibly damaging 0.68
R7501:Synj2 UTSW 17 5990239 missense possibly damaging 0.79
R7730:Synj2 UTSW 17 6016287 missense probably benign 0.33
R7799:Synj2 UTSW 17 6037823 missense probably benign 0.10
R7804:Synj2 UTSW 17 6019534 missense unknown
R7841:Synj2 UTSW 17 6044144 missense unknown
R8347:Synj2 UTSW 17 6009785 missense probably damaging 1.00
R8358:Synj2 UTSW 17 6023805 nonsense probably null
R8391:Synj2 UTSW 17 5941521 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTTCTCCACCCTCACTGAAG -3'
(R):5'- AGGCAACAGGTCACCTTCATG -3'

Sequencing Primer
(F):5'- CCCTCACTGAAGCCCGAC -3'
(R):5'- GCCTGTGGGTCAAACACCTAATG -3'
Posted On2019-06-26