Incidental Mutation 'R7287:Mrpl37'
ID 566074
Institutional Source Beutler Lab
Gene Symbol Mrpl37
Ensembl Gene ENSMUSG00000028622
Gene Name mitochondrial ribosomal protein L37
Synonyms 2300004O14Rik, Rpml2, MRP-L2
MMRRC Submission 045321-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.945) question?
Stock # R7287 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 106913071-106924063 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 106917717 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Serine at position 318 (F318S)
Ref Sequence ENSEMBL: ENSMUSP00000030365 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030365]
AlphaFold Q921S7
Predicted Effect probably damaging
Transcript: ENSMUST00000030365
AA Change: F318S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000030365
Gene: ENSMUSG00000028622
AA Change: F318S

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
Pfam:PDCD9 292 420 6.4e-12 PFAM
Meta Mutation Damage Score 0.8742 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Mammalian mitochondrial ribosomal proteins are encoded by nuclear genes and help in protein synthesis within the mitochondrion. Mitochondrial ribosomes (mitoribosomes) consist of a small 28S subunit and a large 39S subunit. They have an estimated 75% protein to rRNA composition compared to prokaryotic ribosomes, where this ratio is reversed. Another difference between mammalian mitoribosomes and prokaryotic ribosomes is that the latter contain a 5S rRNA. Among different species, the proteins comprising the mitoribosome differ greatly in sequence, and sometimes in biochemical properties, which prevents easy recognition by sequence homology. This gene encodes a 39S subunit protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca3 A G 17: 24,604,861 (GRCm39) D656G possibly damaging Het
Abcc3 C T 11: 94,247,873 (GRCm39) A1207T probably benign Het
Abcc8 T C 7: 45,762,534 (GRCm39) H1209R probably damaging Het
Adam26a T C 8: 44,023,380 (GRCm39) T37A possibly damaging Het
Adamts9 C T 6: 92,866,984 (GRCm39) R685Q possibly damaging Het
Anapc7 T A 5: 122,571,499 (GRCm39) N191K probably benign Het
Ankrd26 C T 6: 118,526,598 (GRCm39) probably null Het
Ap5z1 T C 5: 142,459,802 (GRCm39) L484P probably damaging Het
Arhgap32 A G 9: 32,063,993 (GRCm39) D77G Het
Atp10a T A 7: 58,477,017 (GRCm39) D1213E probably damaging Het
B3gnt8 T C 7: 25,328,395 (GRCm39) L275P probably damaging Het
Bltp2 G A 11: 78,163,709 (GRCm39) R1059H possibly damaging Het
Cab39 A G 1: 85,746,182 (GRCm39) E21G probably benign Het
Capn15 G T 17: 26,179,429 (GRCm39) S948R probably damaging Het
Cbarp T C 10: 79,973,154 (GRCm39) T15A unknown Het
Ccdc81 C T 7: 89,542,331 (GRCm39) A182T probably damaging Het
Ccpg1 A G 9: 72,922,688 (GRCm39) H766R probably benign Het
Cfl1 T C 19: 5,542,562 (GRCm39) V14A probably benign Het
Chd6 A G 2: 160,850,312 (GRCm39) I875T probably benign Het
Cidec T A 6: 113,405,359 (GRCm39) E121D probably benign Het
Clpx C A 9: 65,207,295 (GRCm39) Y64* probably null Het
Cntn1 T A 15: 92,143,833 (GRCm39) probably null Het
Cyp24a1 A G 2: 170,327,826 (GRCm39) L472P probably damaging Het
Dcdc2c G T 12: 28,566,685 (GRCm39) D159E probably benign Het
Emp1 T C 6: 135,357,167 (GRCm39) F82L probably benign Het
Fem1b T C 9: 62,703,404 (GRCm39) T619A probably benign Het
Fgf15 A T 7: 144,450,531 (GRCm39) D39V probably benign Het
Galnt12 T G 4: 47,108,525 (GRCm39) F221V probably damaging Het
Herc6 A G 6: 57,628,965 (GRCm39) probably null Het
Hspg2 G A 4: 137,256,867 (GRCm39) V1537I probably benign Het
Ido2 T C 8: 25,025,154 (GRCm39) probably null Het
Insr G A 8: 3,219,717 (GRCm39) T935I probably benign Het
Itgax G A 7: 127,747,677 (GRCm39) C1031Y probably damaging Het
Kif13a C T 13: 46,905,931 (GRCm39) V671M possibly damaging Het
Kmt5b T C 19: 3,854,501 (GRCm39) Y255H possibly damaging Het
Lrriq1 A T 10: 103,051,877 (GRCm39) Y292N probably benign Het
Nav2 A G 7: 49,070,076 (GRCm39) N311D probably benign Het
Nbeal1 G C 1: 60,276,310 (GRCm39) V684L probably benign Het
Nlrp9b T C 7: 19,762,381 (GRCm39) C673R probably damaging Het
Npnt A G 3: 132,612,563 (GRCm39) V74A probably benign Het
Or10ak12 T A 4: 118,666,939 (GRCm39) T41S probably benign Het
Or1e19 T A 11: 73,316,669 (GRCm39) I47F probably benign Het
Plce1 A T 19: 38,690,347 (GRCm39) Q677L probably benign Het
Pmel C T 10: 128,551,095 (GRCm39) Q113* probably null Het
Pom121l2 T A 13: 22,168,502 (GRCm39) F924L probably benign Het
Poteg G A 8: 27,943,372 (GRCm39) R214K probably null Het
Pprc1 G T 19: 46,059,793 (GRCm39) S1480I unknown Het
Secisbp2l A G 2: 125,582,289 (GRCm39) S1056P probably benign Het
Selenoo T C 15: 88,982,903 (GRCm39) F477L probably benign Het
Senp2 A G 16: 21,837,114 (GRCm39) D121G probably damaging Het
Slc25a11 T C 11: 70,536,181 (GRCm39) D211G probably benign Het
Slc44a2 A G 9: 21,253,752 (GRCm39) D131G probably benign Het
Tcf25 G A 8: 124,100,711 (GRCm39) A34T possibly damaging Het
Tm9sf3 A G 19: 41,205,818 (GRCm39) Y530H probably damaging Het
Tmco3 G A 8: 13,369,605 (GRCm39) probably null Het
Tmem132d G T 5: 128,061,415 (GRCm39) Q396K probably damaging Het
Tmem154 A G 3: 84,597,870 (GRCm39) T136A possibly damaging Het
Tnrc6b A G 15: 80,763,742 (GRCm39) T415A possibly damaging Het
Tonsl T C 15: 76,517,925 (GRCm39) probably null Het
Ttyh1 T C 7: 4,128,657 (GRCm39) Y185H probably benign Het
Ufl1 T A 4: 25,254,852 (GRCm39) T535S probably benign Het
Vmn1r15 T C 6: 57,235,201 (GRCm39) L23P possibly damaging Het
Vmn2r25 T A 6: 123,829,040 (GRCm39) H78L possibly damaging Het
Vmn2r68 T C 7: 84,871,460 (GRCm39) T608A probably benign Het
Vwf A G 6: 125,614,430 (GRCm39) I1104V Het
Zbtb2 C T 10: 4,318,986 (GRCm39) D347N possibly damaging Het
Zfyve9 A T 4: 108,575,453 (GRCm39) S543T probably benign Het
Zhx1 T C 15: 57,916,692 (GRCm39) N518S probably damaging Het
Zmym6 T C 4: 127,016,775 (GRCm39) V852A possibly damaging Het
Other mutations in Mrpl37
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02292:Mrpl37 APN 4 106,917,729 (GRCm39) missense probably damaging 0.96
IGL02451:Mrpl37 APN 4 106,923,839 (GRCm39) missense probably damaging 1.00
R0088:Mrpl37 UTSW 4 106,921,621 (GRCm39) missense possibly damaging 0.65
R0271:Mrpl37 UTSW 4 106,923,658 (GRCm39) missense possibly damaging 0.80
R1445:Mrpl37 UTSW 4 106,921,692 (GRCm39) missense probably benign 0.00
R2566:Mrpl37 UTSW 4 106,921,690 (GRCm39) missense possibly damaging 0.95
R4751:Mrpl37 UTSW 4 106,914,672 (GRCm39) missense probably damaging 1.00
R5088:Mrpl37 UTSW 4 106,921,919 (GRCm39) missense probably damaging 1.00
R5664:Mrpl37 UTSW 4 106,921,588 (GRCm39) missense probably benign 0.06
R5870:Mrpl37 UTSW 4 106,923,919 (GRCm39) missense probably benign
R5996:Mrpl37 UTSW 4 106,923,704 (GRCm39) missense probably benign
R6163:Mrpl37 UTSW 4 106,921,793 (GRCm39) missense possibly damaging 0.94
R8754:Mrpl37 UTSW 4 106,921,611 (GRCm39) missense probably benign 0.28
R9334:Mrpl37 UTSW 4 106,921,605 (GRCm39) missense probably benign 0.13
X0067:Mrpl37 UTSW 4 106,923,676 (GRCm39) missense possibly damaging 0.93
Z1176:Mrpl37 UTSW 4 106,914,623 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTAGAGAGCCACTGTGTCTG -3'
(R):5'- GACATCTGTGAGCCTGGTTG -3'

Sequencing Primer
(F):5'- GCAGGTTGCTACAAGTTAAGC -3'
(R):5'- AGCCTGGTTGTGTTCTATGTCTCC -3'
Posted On 2019-06-26