Incidental Mutation 'R7287:Ap5z1'
ID 566081
Institutional Source Beutler Lab
Gene Symbol Ap5z1
Ensembl Gene ENSMUSG00000039623
Gene Name adaptor-related protein complex 5, zeta 1 subunit
Synonyms C330006K01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.298) question?
Stock # R7287 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 142463944-142478710 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 142474047 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 484 (L484P)
Ref Sequence ENSEMBL: ENSMUSP00000041863 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038699] [ENSMUST00000196055]
AlphaFold Q3U829
Predicted Effect probably damaging
Transcript: ENSMUST00000038699
AA Change: L484P

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000041863
Gene: ENSMUSG00000039623
AA Change: L484P

DomainStartEndE-ValueType
low complexity region 271 294 N/A INTRINSIC
Pfam:SPG48 319 437 2.9e-45 PFAM
low complexity region 579 584 N/A INTRINSIC
low complexity region 617 628 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000196055
AA Change: L484P

PolyPhen 2 Score 0.963 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000143179
Gene: ENSMUSG00000039623
AA Change: L484P

DomainStartEndE-ValueType
low complexity region 271 294 N/A INTRINSIC
Pfam:SPG48 318 758 2.6e-181 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified by genome-wide screen for genes involved in homologous recombination DNA double-strand break repair (HR-DSBR). The encoded protein was found in a complex with other proteins that have a role in HR-DSBR. Knockdown of this gene reduced homologous recombination, and mutations in this gene were found in patients with spastic paraplegia. It was concluded that this gene likely encodes a helicase (PMID:20613862). [provided by RefSeq, Jan 2011]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik G A 11: 78,272,883 R1059H possibly damaging Het
Abca3 A G 17: 24,385,887 D656G possibly damaging Het
Abcc3 C T 11: 94,357,047 A1207T probably benign Het
Abcc8 T C 7: 46,113,110 H1209R probably damaging Het
Adam26a T C 8: 43,570,343 T37A possibly damaging Het
Adamts9 C T 6: 92,890,003 R685Q possibly damaging Het
Anapc7 T A 5: 122,433,436 N191K probably benign Het
Ankrd26 C T 6: 118,549,637 probably null Het
Arhgap32 A G 9: 32,152,697 D77G Het
Atp10a T A 7: 58,827,269 D1213E probably damaging Het
B3gnt8 T C 7: 25,628,970 L275P probably damaging Het
Cab39 A G 1: 85,818,461 E21G probably benign Het
Capn15 G T 17: 25,960,455 S948R probably damaging Het
Cbarp T C 10: 80,137,320 T15A unknown Het
Ccdc81 C T 7: 89,893,123 A182T probably damaging Het
Ccpg1 A G 9: 73,015,406 H766R probably benign Het
Cfl1 T C 19: 5,492,534 V14A probably benign Het
Chd6 A G 2: 161,008,392 I875T probably benign Het
Cidec T A 6: 113,428,398 E121D probably benign Het
Clpx C A 9: 65,300,013 Y64* probably null Het
Cntn1 T A 15: 92,245,952 probably null Het
Cyp24a1 A G 2: 170,485,906 L472P probably damaging Het
Dcdc2c G T 12: 28,516,686 D159E probably benign Het
Emp1 T C 6: 135,380,169 F82L probably benign Het
Fem1b T C 9: 62,796,122 T619A probably benign Het
Fgf15 A T 7: 144,896,794 D39V probably benign Het
Galnt12 T G 4: 47,108,525 F221V probably damaging Het
Herc6 A G 6: 57,651,980 probably null Het
Hspg2 G A 4: 137,529,556 V1537I probably benign Het
Ido2 T C 8: 24,535,138 probably null Het
Insr G A 8: 3,169,717 T935I probably benign Het
Itgax G A 7: 128,148,505 C1031Y probably damaging Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Kmt5b T C 19: 3,804,501 Y255H possibly damaging Het
Lrriq1 A T 10: 103,216,016 Y292N probably benign Het
Mrpl37 A G 4: 107,060,520 F318S probably damaging Het
Nav2 A G 7: 49,420,328 N311D probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nlrp9b T C 7: 20,028,456 C673R probably damaging Het
Npnt A G 3: 132,906,802 V74A probably benign Het
Olfr1335 T A 4: 118,809,742 T41S probably benign Het
Olfr378 T A 11: 73,425,843 I47F probably benign Het
Plce1 A T 19: 38,701,903 Q677L probably benign Het
Pmel C T 10: 128,715,226 Q113* probably null Het
Pom121l2 T A 13: 21,984,332 F924L probably benign Het
Poteg G A 8: 27,453,344 R214K probably null Het
Pprc1 G T 19: 46,071,354 S1480I unknown Het
Secisbp2l A G 2: 125,740,369 S1056P probably benign Het
Selenoo T C 15: 89,098,700 F477L probably benign Het
Senp2 A G 16: 22,018,364 D121G probably damaging Het
Slc25a11 T C 11: 70,645,355 D211G probably benign Het
Slc44a2 A G 9: 21,342,456 D131G probably benign Het
Tcf25 G A 8: 123,373,972 A34T possibly damaging Het
Tm9sf3 A G 19: 41,217,379 Y530H probably damaging Het
Tmco3 G A 8: 13,319,605 probably null Het
Tmem132d G T 5: 127,984,351 Q396K probably damaging Het
Tmem154 A G 3: 84,690,563 T136A possibly damaging Het
Tnrc6b A G 15: 80,879,541 T415A possibly damaging Het
Tonsl T C 15: 76,633,725 probably null Het
Ttyh1 T C 7: 4,125,658 Y185H probably benign Het
Ufl1 T A 4: 25,254,852 T535S probably benign Het
Vmn1r15 T C 6: 57,258,216 L23P possibly damaging Het
Vmn2r25 T A 6: 123,852,081 H78L possibly damaging Het
Vmn2r68 T C 7: 85,222,252 T608A probably benign Het
Vwf A G 6: 125,637,467 I1104V Het
Zbtb2 C T 10: 4,368,986 D347N possibly damaging Het
Zfyve9 A T 4: 108,718,256 S543T probably benign Het
Zhx1 T C 15: 58,053,296 N518S probably damaging Het
Zmym6 T C 4: 127,122,982 V852A possibly damaging Het
Other mutations in Ap5z1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01382:Ap5z1 APN 5 142472251 missense probably benign 0.02
IGL01456:Ap5z1 APN 5 142468036 missense probably damaging 0.96
IGL01656:Ap5z1 APN 5 142470314 missense probably benign 0.10
IGL02079:Ap5z1 APN 5 142477113 critical splice donor site probably null
IGL02134:Ap5z1 APN 5 142474459 missense probably benign 0.09
IGL02662:Ap5z1 APN 5 142476889 splice site probably null
IGL02805:Ap5z1 APN 5 142470283 unclassified probably benign
R0057:Ap5z1 UTSW 5 142470389 unclassified probably benign
R0057:Ap5z1 UTSW 5 142470389 unclassified probably benign
R0094:Ap5z1 UTSW 5 142476812 missense probably benign 0.00
R0395:Ap5z1 UTSW 5 142470562 unclassified probably benign
R0811:Ap5z1 UTSW 5 142475791 missense probably benign 0.00
R0812:Ap5z1 UTSW 5 142475791 missense probably benign 0.00
R1241:Ap5z1 UTSW 5 142470114 missense probably damaging 1.00
R1248:Ap5z1 UTSW 5 142474500 missense probably benign 0.02
R1374:Ap5z1 UTSW 5 142470458 missense probably damaging 1.00
R1616:Ap5z1 UTSW 5 142472236 missense probably benign 0.10
R1923:Ap5z1 UTSW 5 142472341 missense probably benign 0.30
R2423:Ap5z1 UTSW 5 142476777 missense probably benign 0.02
R3790:Ap5z1 UTSW 5 142470413 missense probably benign
R4859:Ap5z1 UTSW 5 142473993 missense possibly damaging 0.75
R4965:Ap5z1 UTSW 5 142467676 missense probably damaging 1.00
R5147:Ap5z1 UTSW 5 142466510 missense probably benign 0.02
R5311:Ap5z1 UTSW 5 142467687 missense possibly damaging 0.79
R5531:Ap5z1 UTSW 5 142467781 missense probably benign
R5569:Ap5z1 UTSW 5 142474451 missense probably damaging 0.99
R5725:Ap5z1 UTSW 5 142468976 missense probably damaging 1.00
R7407:Ap5z1 UTSW 5 142466575 missense probably benign 0.06
R7537:Ap5z1 UTSW 5 142477298 missense probably benign 0.06
R7894:Ap5z1 UTSW 5 142466284 missense probably benign 0.34
R7894:Ap5z1 UTSW 5 142470436 nonsense probably null
R7895:Ap5z1 UTSW 5 142470558 critical splice donor site probably null
R8022:Ap5z1 UTSW 5 142470149 critical splice donor site probably null
R8244:Ap5z1 UTSW 5 142473980 missense possibly damaging 0.60
R8823:Ap5z1 UTSW 5 142474436 missense probably benign 0.19
R8867:Ap5z1 UTSW 5 142477256 missense probably benign 0.05
R9673:Ap5z1 UTSW 5 142477358 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- GCTGAGCTGTCTTGTTCACC -3'
(R):5'- ATAACATCACAGGCTCTCGGG -3'

Sequencing Primer
(F):5'- GTCTTGTTCACCCCCGCAG -3'
(R):5'- GAGGCTCCTCTTCATGAACATGAG -3'
Posted On 2019-06-26