Incidental Mutation 'R0635:Glg1'
ID 56609
Institutional Source Beutler Lab
Gene Symbol Glg1
Ensembl Gene ENSMUSG00000003316
Gene Name golgi apparatus protein 1
Synonyms MG160, CFR-1, MG-160, Selel, ESL-1, CFR
MMRRC Submission 038824-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.357) question?
Stock # R0635 (G1)
Quality Score 225
Status Validated
Chromosome 8
Chromosomal Location 111881053-111985848 bp(-) (GRCm39)
Type of Mutation splice site
DNA Base Change (assembly) A to G at 111890396 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000131355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003404] [ENSMUST00000164283] [ENSMUST00000168741] [ENSMUST00000169020]
AlphaFold Q61543
Predicted Effect probably benign
Transcript: ENSMUST00000003404
SMART Domains Protein: ENSMUSP00000003404
Gene: ENSMUSG00000003316

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cys_rich_FGFR 141 197 3.1e-13 PFAM
Pfam:Cys_rich_FGFR 199 263 1.3e-16 PFAM
Pfam:Cys_rich_FGFR 274 331 1.5e-16 PFAM
Pfam:Cys_rich_FGFR 334 398 1.6e-16 PFAM
Pfam:Cys_rich_FGFR 402 458 1.8e-15 PFAM
Pfam:Cys_rich_FGFR 463 522 2.3e-16 PFAM
Pfam:Cys_rich_FGFR 525 589 5.8e-19 PFAM
Pfam:Cys_rich_FGFR 597 653 6e-17 PFAM
Pfam:Cys_rich_FGFR 654 714 2e-14 PFAM
Pfam:Cys_rich_FGFR 717 773 4.7e-14 PFAM
Pfam:Cys_rich_FGFR 784 841 1e-18 PFAM
Pfam:Cys_rich_FGFR 842 897 4.2e-17 PFAM
Pfam:Cys_rich_FGFR 900 964 2.1e-21 PFAM
Pfam:Cys_rich_FGFR 967 1027 3.5e-16 PFAM
Pfam:Cys_rich_FGFR 1029 1086 8e-17 PFAM
transmembrane domain 1131 1153 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164283
SMART Domains Protein: ENSMUSP00000131659
Gene: ENSMUSG00000003316

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cys_rich_FGFR 149 208 2.3e-16 PFAM
Pfam:Cys_rich_FGFR 210 267 1.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000168741
SMART Domains Protein: ENSMUSP00000130327
Gene: ENSMUSG00000003316

DomainStartEndE-ValueType
Pfam:Cys_rich_FGFR 1 57 2.6e-17 PFAM
Pfam:Cys_rich_FGFR 58 118 8.5e-15 PFAM
Pfam:Cys_rich_FGFR 121 177 2e-14 PFAM
Pfam:Cys_rich_FGFR 188 245 4.3e-19 PFAM
Pfam:Cys_rich_FGFR 246 301 1.8e-17 PFAM
Pfam:Cys_rich_FGFR 304 368 8.9e-22 PFAM
Pfam:Cys_rich_FGFR 371 431 1.5e-16 PFAM
Pfam:Cys_rich_FGFR 459 513 1.6e-15 PFAM
transmembrane domain 558 580 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169020
SMART Domains Protein: ENSMUSP00000131355
Gene: ENSMUSG00000003316

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cys_rich_FGFR 149 208 2.9e-15 PFAM
Pfam:Cys_rich_FGFR 210 274 1.3e-16 PFAM
Pfam:Cys_rich_FGFR 285 342 1.4e-16 PFAM
Pfam:Cys_rich_FGFR 345 409 7.2e-16 PFAM
Pfam:Cys_rich_FGFR 413 469 8.4e-16 PFAM
Pfam:Cys_rich_FGFR 474 533 6.4e-17 PFAM
Pfam:Cys_rich_FGFR 536 600 2.7e-16 PFAM
Pfam:Cys_rich_FGFR 608 664 2.6e-17 PFAM
Pfam:Cys_rich_FGFR 665 725 1.2e-13 PFAM
Pfam:Cys_rich_FGFR 728 784 2.6e-11 PFAM
Pfam:Cys_rich_FGFR 795 852 1.4e-18 PFAM
Pfam:Cys_rich_FGFR 853 908 1.1e-15 PFAM
Pfam:Cys_rich_FGFR 911 975 1e-19 PFAM
Pfam:Cys_rich_FGFR 978 1038 1.3e-15 PFAM
Pfam:Cys_rich_FGFR 1040 1097 6e-17 PFAM
transmembrane domain 1142 1164 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.4%
  • 20x: 94.9%
Validation Efficiency 99% (68/69)
MGI Phenotype PHENOTYPE: Nullizygous mice show smaller size, narrow rib cages, short and thin bony elements, and reduced chondrocyte proliferation and growth plates. Homozygotes for a gene trap allele show postnatal death, small size, distorted tails and cleft palate. Homozygotes for another gene trap allele die by E10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730455P16Rik A T 11: 80,264,891 (GRCm39) probably benign Het
Adamts15 A G 9: 30,816,066 (GRCm39) L631P probably damaging Het
Adamts17 T C 7: 66,558,353 (GRCm39) F266L probably damaging Het
Adgrb1 C A 15: 74,412,741 (GRCm39) Q488K possibly damaging Het
Armh4 A G 14: 50,010,600 (GRCm39) L369S probably benign Het
Cep290 A G 10: 100,328,538 (GRCm39) D109G probably damaging Het
Chil5 A T 3: 105,924,519 (GRCm39) Y229N possibly damaging Het
Cntnap1 A G 11: 101,074,285 (GRCm39) T742A probably benign Het
Col6a3 A T 1: 90,735,808 (GRCm39) probably null Het
Col6a5 G A 9: 105,805,805 (GRCm39) P1034S unknown Het
Daxx T A 17: 34,131,618 (GRCm39) D442E probably benign Het
Dmxl1 T C 18: 49,984,490 (GRCm39) probably benign Het
Dnah11 A G 12: 117,971,731 (GRCm39) F2942S probably damaging Het
Garin4 T C 1: 190,895,924 (GRCm39) T240A probably benign Het
Gm10272 G A 10: 77,542,535 (GRCm39) probably benign Het
Gm17333 AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA AAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAAGAGAA 16: 77,649,766 (GRCm39) noncoding transcript Het
Haao A G 17: 84,146,003 (GRCm39) F83S probably damaging Het
Hdgfl2 T A 17: 56,403,057 (GRCm39) L177Q probably damaging Het
Hrh1 T C 6: 114,457,106 (GRCm39) V129A probably damaging Het
Ift43 T A 12: 86,131,855 (GRCm39) probably benign Het
Il21r T C 7: 125,231,678 (GRCm39) Y369H probably damaging Het
Il2ra C T 2: 11,685,177 (GRCm39) T171M probably benign Het
Lao1 C T 4: 118,825,493 (GRCm39) R438C probably benign Het
Lrrcc1 G A 3: 14,624,288 (GRCm39) S350N probably benign Het
Mageb5 T A X: 90,823,599 (GRCm39) Y260F probably benign Het
Marchf5 A T 19: 37,197,807 (GRCm39) I159F possibly damaging Het
Mgat4a G A 1: 37,491,375 (GRCm39) A282V probably benign Het
Mipep G A 14: 61,066,839 (GRCm39) V420I probably damaging Het
Morc2b A T 17: 33,356,661 (GRCm39) F370L possibly damaging Het
Mt1 A T 8: 94,906,449 (GRCm39) probably null Het
Ncapd2 A G 6: 125,149,999 (GRCm39) V943A probably benign Het
Nkd2 T C 13: 73,975,013 (GRCm39) D58G probably benign Het
Nol8 C G 13: 49,830,234 (GRCm39) S1106C probably benign Het
Nrm C A 17: 36,175,156 (GRCm39) Y61* probably null Het
Nusap1 A G 2: 119,458,148 (GRCm39) T95A probably damaging Het
Ocln T A 13: 100,642,744 (GRCm39) Q197L probably damaging Het
Or5p70 T A 7: 107,994,971 (GRCm39) F215I probably benign Het
Oxtr A G 6: 112,466,161 (GRCm39) Y200H probably damaging Het
Paip2b T C 6: 83,786,891 (GRCm39) E115G possibly damaging Het
Pcm1 T A 8: 41,720,216 (GRCm39) probably benign Het
Pcnt T C 10: 76,240,419 (GRCm39) D1205G probably damaging Het
Phka1 G A X: 101,665,006 (GRCm39) R186C probably damaging Het
Pik3cb A G 9: 98,946,271 (GRCm39) probably benign Het
Pik3r1 C T 13: 101,893,926 (GRCm39) R81K probably benign Het
Ppa1 A G 10: 61,501,219 (GRCm39) D162G probably benign Het
Ppa1 A G 10: 61,502,749 (GRCm39) R191G probably damaging Het
Ppp4r3c2 T C X: 88,796,128 (GRCm39) probably benign Het
Prss22 T A 17: 24,215,662 (GRCm39) T87S probably benign Het
Rgr T A 14: 36,760,904 (GRCm39) R218* probably null Het
Rreb1 A T 13: 38,125,540 (GRCm39) Q1282L possibly damaging Het
Scel T A 14: 103,820,575 (GRCm39) probably null Het
Sema6b A G 17: 56,436,971 (GRCm39) probably null Het
Slc4a1 T C 11: 102,243,498 (GRCm39) E711G possibly damaging Het
Snx19 C A 9: 30,340,106 (GRCm39) L415M probably damaging Het
Snx19 T G 9: 30,340,107 (GRCm39) L415R probably damaging Het
Specc1 G A 11: 62,009,729 (GRCm39) R495Q probably damaging Het
Tead1 T C 7: 112,490,913 (GRCm39) probably benign Het
Timm10b A C 7: 105,289,895 (GRCm39) probably benign Het
Ubxn7 T A 16: 32,186,235 (GRCm39) probably benign Het
Vmn2r116 T A 17: 23,605,861 (GRCm39) Y258N possibly damaging Het
Vmn2r77 T A 7: 86,460,383 (GRCm39) F570I probably benign Het
Vmn2r98 T C 17: 19,300,759 (GRCm39) V587A probably benign Het
Zfp398 T C 6: 47,840,074 (GRCm39) I101T probably damaging Het
Zfp808 T A 13: 62,320,233 (GRCm39) H487Q probably damaging Het
Other mutations in Glg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Glg1 APN 8 111,886,481 (GRCm39) missense probably damaging 1.00
IGL01326:Glg1 APN 8 111,909,205 (GRCm39) missense probably damaging 0.96
IGL01558:Glg1 APN 8 111,914,362 (GRCm39) missense probably benign 0.00
IGL01798:Glg1 APN 8 111,919,332 (GRCm39) missense possibly damaging 0.58
IGL02651:Glg1 APN 8 111,887,359 (GRCm39) missense possibly damaging 0.76
IGL03124:Glg1 APN 8 111,926,803 (GRCm39) missense probably damaging 1.00
IGL03374:Glg1 APN 8 111,889,412 (GRCm39) missense probably damaging 1.00
IGL03404:Glg1 APN 8 111,886,534 (GRCm39) missense probably damaging 1.00
diabolical UTSW 8 111,895,375 (GRCm39) missense probably damaging 1.00
BB007:Glg1 UTSW 8 111,887,367 (GRCm39) missense possibly damaging 0.46
BB017:Glg1 UTSW 8 111,887,367 (GRCm39) missense possibly damaging 0.46
PIT4362001:Glg1 UTSW 8 111,985,431 (GRCm39) missense possibly damaging 0.80
R0047:Glg1 UTSW 8 111,892,214 (GRCm39) missense probably damaging 1.00
R0047:Glg1 UTSW 8 111,892,214 (GRCm39) missense probably damaging 1.00
R0255:Glg1 UTSW 8 111,886,490 (GRCm39) missense possibly damaging 0.82
R0432:Glg1 UTSW 8 111,909,201 (GRCm39) missense probably damaging 1.00
R0458:Glg1 UTSW 8 111,887,238 (GRCm39) splice site probably benign
R0765:Glg1 UTSW 8 111,886,429 (GRCm39) critical splice donor site probably null
R1104:Glg1 UTSW 8 111,924,235 (GRCm39) missense probably benign 0.01
R1495:Glg1 UTSW 8 111,924,307 (GRCm39) missense probably damaging 1.00
R1747:Glg1 UTSW 8 111,924,305 (GRCm39) missense probably damaging 1.00
R1899:Glg1 UTSW 8 111,892,306 (GRCm39) missense probably benign 0.23
R1950:Glg1 UTSW 8 111,892,271 (GRCm39) missense possibly damaging 0.79
R2074:Glg1 UTSW 8 111,895,303 (GRCm39) missense probably damaging 1.00
R2112:Glg1 UTSW 8 111,919,178 (GRCm39) missense probably damaging 1.00
R2275:Glg1 UTSW 8 111,895,353 (GRCm39) nonsense probably null
R2342:Glg1 UTSW 8 111,914,439 (GRCm39) nonsense probably null
R4633:Glg1 UTSW 8 111,904,276 (GRCm39) critical splice donor site probably null
R4716:Glg1 UTSW 8 111,887,407 (GRCm39) nonsense probably null
R4732:Glg1 UTSW 8 111,914,387 (GRCm39) missense probably damaging 1.00
R4733:Glg1 UTSW 8 111,914,387 (GRCm39) missense probably damaging 1.00
R5594:Glg1 UTSW 8 111,914,513 (GRCm39) missense probably damaging 1.00
R5722:Glg1 UTSW 8 111,896,194 (GRCm39) missense possibly damaging 0.67
R5951:Glg1 UTSW 8 111,892,323 (GRCm39) missense possibly damaging 0.64
R5958:Glg1 UTSW 8 111,985,736 (GRCm39) missense probably benign 0.01
R6090:Glg1 UTSW 8 111,907,667 (GRCm39) missense probably damaging 1.00
R6476:Glg1 UTSW 8 111,926,806 (GRCm39) missense possibly damaging 0.94
R6480:Glg1 UTSW 8 111,924,338 (GRCm39) missense possibly damaging 0.89
R6819:Glg1 UTSW 8 111,914,513 (GRCm39) missense probably damaging 1.00
R7116:Glg1 UTSW 8 111,905,589 (GRCm39) missense probably benign 0.22
R7293:Glg1 UTSW 8 111,895,375 (GRCm39) missense probably damaging 1.00
R7431:Glg1 UTSW 8 111,887,386 (GRCm39) missense unknown
R7479:Glg1 UTSW 8 111,924,367 (GRCm39) missense possibly damaging 0.91
R7509:Glg1 UTSW 8 111,985,675 (GRCm39) missense probably benign 0.04
R7547:Glg1 UTSW 8 111,914,393 (GRCm39) missense possibly damaging 0.89
R7678:Glg1 UTSW 8 111,905,497 (GRCm39) missense probably benign 0.19
R7930:Glg1 UTSW 8 111,887,367 (GRCm39) missense possibly damaging 0.46
R8182:Glg1 UTSW 8 111,897,929 (GRCm39) missense possibly damaging 0.88
R8383:Glg1 UTSW 8 111,896,194 (GRCm39) missense possibly damaging 0.67
R8787:Glg1 UTSW 8 111,888,114 (GRCm39) missense probably damaging 0.99
R8905:Glg1 UTSW 8 111,884,668 (GRCm39) missense probably damaging 0.99
R8954:Glg1 UTSW 8 111,914,527 (GRCm39) missense probably damaging 1.00
R8958:Glg1 UTSW 8 111,899,116 (GRCm39) nonsense probably null
R9023:Glg1 UTSW 8 111,904,380 (GRCm39) missense probably damaging 0.99
R9113:Glg1 UTSW 8 111,887,452 (GRCm39) intron probably benign
R9359:Glg1 UTSW 8 111,914,425 (GRCm39) missense probably benign 0.08
R9403:Glg1 UTSW 8 111,914,425 (GRCm39) missense probably benign 0.08
R9553:Glg1 UTSW 8 111,926,770 (GRCm39) missense probably benign 0.04
R9622:Glg1 UTSW 8 111,899,133 (GRCm39) missense probably damaging 1.00
R9714:Glg1 UTSW 8 111,924,301 (GRCm39) missense probably damaging 1.00
X0027:Glg1 UTSW 8 111,896,232 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGTACAAGGTTTCCCAGGCAAGAG -3'
(R):5'- AGCTGTTCCCTGCTTACGTCAAG -3'

Sequencing Primer
(F):5'- GGCAAGAGCTGAAATTTTCCCTC -3'
(R):5'- GCTTACGTCAAGTGATGCC -3'
Posted On 2013-07-11