Incidental Mutation 'R7287:Vmn2r68'
ID566095
Institutional Source Beutler Lab
Gene Symbol Vmn2r68
Ensembl Gene ENSMUSG00000096861
Gene Namevomeronasal 2, receptor 68
SynonymsVmn2r68-ps, EG620697
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R7287 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location85221518-85237704 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 85222252 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 608 (T608A)
Ref Sequence ENSEMBL: ENSMUSP00000129411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061074]
Predicted Effect probably benign
Transcript: ENSMUST00000061074
AA Change: T608A

PolyPhen 2 Score 0.330 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000129411
Gene: ENSMUSG00000096861
AA Change: T608A

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 463 4.5e-28 PFAM
Pfam:NCD3G 507 559 1.1e-18 PFAM
Pfam:7tm_3 589 827 3.7e-53 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (71/71)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik G A 11: 78,272,883 R1059H possibly damaging Het
Abca3 A G 17: 24,385,887 D656G possibly damaging Het
Abcc3 C T 11: 94,357,047 A1207T probably benign Het
Abcc8 T C 7: 46,113,110 H1209R probably damaging Het
Adam26a T C 8: 43,570,343 T37A possibly damaging Het
Adamts9 C T 6: 92,890,003 R685Q possibly damaging Het
Anapc7 T A 5: 122,433,436 N191K probably benign Het
Ankrd26 C T 6: 118,549,637 probably null Het
Ap5z1 T C 5: 142,474,047 L484P probably damaging Het
Arhgap32 A G 9: 32,152,697 D77G Het
Atp10a T A 7: 58,827,269 D1213E probably damaging Het
B3gnt8 T C 7: 25,628,970 L275P probably damaging Het
Cab39 A G 1: 85,818,461 E21G probably benign Het
Capn15 G T 17: 25,960,455 S948R probably damaging Het
Cbarp T C 10: 80,137,320 T15A unknown Het
Ccdc81 C T 7: 89,893,123 A182T probably damaging Het
Ccpg1 A G 9: 73,015,406 H766R probably benign Het
Cfl1 T C 19: 5,492,534 V14A probably benign Het
Chd6 A G 2: 161,008,392 I875T probably benign Het
Cidec T A 6: 113,428,398 E121D probably benign Het
Clpx C A 9: 65,300,013 Y64* probably null Het
Cntn1 T A 15: 92,245,952 probably null Het
Cyp24a1 A G 2: 170,485,906 L472P probably damaging Het
Dcdc2c G T 12: 28,516,686 D159E probably benign Het
Emp1 T C 6: 135,380,169 F82L probably benign Het
Fem1b T C 9: 62,796,122 T619A probably benign Het
Fgf15 A T 7: 144,896,794 D39V probably benign Het
Galnt12 T G 4: 47,108,525 F221V probably damaging Het
Herc6 A G 6: 57,651,980 probably null Het
Hspg2 G A 4: 137,529,556 V1537I probably benign Het
Ido2 T C 8: 24,535,138 probably null Het
Insr G A 8: 3,169,717 T935I probably benign Het
Itgax G A 7: 128,148,505 C1031Y probably damaging Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Kmt5b T C 19: 3,804,501 Y255H possibly damaging Het
Lrriq1 A T 10: 103,216,016 Y292N probably benign Het
Mrpl37 A G 4: 107,060,520 F318S probably damaging Het
Nav2 A G 7: 49,420,328 N311D probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nlrp9b T C 7: 20,028,456 C673R probably damaging Het
Npnt A G 3: 132,906,802 V74A probably benign Het
Olfr1335 T A 4: 118,809,742 T41S probably benign Het
Olfr378 T A 11: 73,425,843 I47F probably benign Het
Plce1 A T 19: 38,701,903 Q677L probably benign Het
Pmel C T 10: 128,715,226 Q113* probably null Het
Pom121l2 T A 13: 21,984,332 F924L probably benign Het
Poteg G A 8: 27,453,344 R214K probably null Het
Pprc1 G T 19: 46,071,354 S1480I unknown Het
Secisbp2l A G 2: 125,740,369 S1056P probably benign Het
Selenoo T C 15: 89,098,700 F477L probably benign Het
Senp2 A G 16: 22,018,364 D121G probably damaging Het
Slc25a11 T C 11: 70,645,355 D211G probably benign Het
Slc44a2 A G 9: 21,342,456 D131G probably benign Het
Tcf25 G A 8: 123,373,972 A34T possibly damaging Het
Tm9sf3 A G 19: 41,217,379 Y530H probably damaging Het
Tmco3 G A 8: 13,319,605 probably null Het
Tmem132d G T 5: 127,984,351 Q396K probably damaging Het
Tmem154 A G 3: 84,690,563 T136A possibly damaging Het
Tnrc6b A G 15: 80,879,541 T415A possibly damaging Het
Tonsl T C 15: 76,633,725 probably null Het
Ttyh1 T C 7: 4,125,658 Y185H probably benign Het
Ufl1 T A 4: 25,254,852 T535S probably benign Het
Vmn1r15 T C 6: 57,258,216 L23P possibly damaging Het
Vmn2r25 T A 6: 123,852,081 H78L possibly damaging Het
Vwf A G 6: 125,637,467 I1104V Het
Zbtb2 C T 10: 4,368,986 D347N possibly damaging Het
Zfyve9 A T 4: 108,718,256 S543T probably benign Het
Zhx1 T C 15: 58,053,296 N518S probably damaging Het
Zmym6 T C 4: 127,122,982 V852A possibly damaging Het
Other mutations in Vmn2r68
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Vmn2r68 APN 7 85237611 missense probably benign
IGL01477:Vmn2r68 APN 7 85233483 missense probably damaging 1.00
IGL01600:Vmn2r68 APN 7 85222260 missense probably benign 0.39
IGL01979:Vmn2r68 APN 7 85222117 missense probably benign
IGL01999:Vmn2r68 APN 7 85222231 missense probably damaging 1.00
IGL02269:Vmn2r68 APN 7 85221739 missense possibly damaging 0.84
IGL02517:Vmn2r68 APN 7 85221945 nonsense probably null
IGL02827:Vmn2r68 APN 7 85237592 missense probably damaging 1.00
IGL02852:Vmn2r68 APN 7 85233387 missense probably damaging 1.00
IGL02982:Vmn2r68 APN 7 85234441 missense probably benign 0.12
IGL03099:Vmn2r68 APN 7 85222240 nonsense probably null
IGL03166:Vmn2r68 APN 7 85222123 missense probably benign 0.01
IGL03168:Vmn2r68 APN 7 85221764 missense probably damaging 1.00
IGL03243:Vmn2r68 APN 7 85233755 missense possibly damaging 0.66
F5770:Vmn2r68 UTSW 7 85221880 missense probably benign 0.01
R0280:Vmn2r68 UTSW 7 85233249 splice site probably benign
R0280:Vmn2r68 UTSW 7 85233258 critical splice donor site probably null
R0281:Vmn2r68 UTSW 7 85233249 splice site probably benign
R0281:Vmn2r68 UTSW 7 85233258 critical splice donor site probably null
R0348:Vmn2r68 UTSW 7 85221676 missense possibly damaging 0.50
R0390:Vmn2r68 UTSW 7 85233249 splice site probably benign
R0390:Vmn2r68 UTSW 7 85233258 critical splice donor site probably null
R0722:Vmn2r68 UTSW 7 85221586 missense possibly damaging 0.95
R1129:Vmn2r68 UTSW 7 85237504 splice site probably null
R1136:Vmn2r68 UTSW 7 85222341 missense possibly damaging 0.81
R1319:Vmn2r68 UTSW 7 85232492 missense probably damaging 0.96
R1614:Vmn2r68 UTSW 7 85221738 missense possibly damaging 0.93
R1682:Vmn2r68 UTSW 7 85233366 missense possibly damaging 0.68
R1837:Vmn2r68 UTSW 7 85233678 missense probably damaging 0.96
R1893:Vmn2r68 UTSW 7 85234659 nonsense probably null
R1908:Vmn2r68 UTSW 7 85234052 missense probably benign 0.09
R1909:Vmn2r68 UTSW 7 85234052 missense probably benign 0.09
R1951:Vmn2r68 UTSW 7 85233894 missense probably damaging 1.00
R2177:Vmn2r68 UTSW 7 85221915 missense probably benign 0.01
R2178:Vmn2r68 UTSW 7 85221550 frame shift probably null
R2185:Vmn2r68 UTSW 7 85233693 nonsense probably null
R2188:Vmn2r68 UTSW 7 85221550 frame shift probably null
R2282:Vmn2r68 UTSW 7 85221651 missense possibly damaging 0.65
R2567:Vmn2r68 UTSW 7 85234595 missense probably benign
R2869:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2869:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2870:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2870:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2871:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2871:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2873:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2874:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R3149:Vmn2r68 UTSW 7 85237667 missense probably benign 0.00
R3401:Vmn2r68 UTSW 7 85221550 frame shift probably null
R3978:Vmn2r68 UTSW 7 85232462 missense probably benign 0.00
R4399:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4401:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4421:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4478:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4479:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4495:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4628:Vmn2r68 UTSW 7 85234465 missense probably benign 0.00
R4649:Vmn2r68 UTSW 7 85221535 missense probably benign
R4654:Vmn2r68 UTSW 7 85233561 nonsense probably null
R4793:Vmn2r68 UTSW 7 85234440 missense probably benign 0.01
R5007:Vmn2r68 UTSW 7 85232414 missense probably benign
R5021:Vmn2r68 UTSW 7 85233734 missense possibly damaging 0.62
R5082:Vmn2r68 UTSW 7 85233868 missense probably benign 0.12
R5177:Vmn2r68 UTSW 7 85221991 missense probably damaging 0.99
R5221:Vmn2r68 UTSW 7 85221877 missense probably damaging 1.00
R5514:Vmn2r68 UTSW 7 85237559 missense possibly damaging 0.92
R5521:Vmn2r68 UTSW 7 85233718 missense probably benign 0.03
R5563:Vmn2r68 UTSW 7 85222075 missense probably damaging 1.00
R5664:Vmn2r68 UTSW 7 85233770 missense probably benign 0.02
R5829:Vmn2r68 UTSW 7 85237604 missense probably benign 0.00
R6016:Vmn2r68 UTSW 7 85222245 missense probably damaging 0.99
R6356:Vmn2r68 UTSW 7 85233840 missense possibly damaging 0.85
R6413:Vmn2r68 UTSW 7 85221765 missense probably damaging 1.00
R6418:Vmn2r68 UTSW 7 85233707 missense probably benign
R6699:Vmn2r68 UTSW 7 85232375 missense possibly damaging 0.58
R7319:Vmn2r68 UTSW 7 85233834 missense probably benign
R7374:Vmn2r68 UTSW 7 85232399 missense possibly damaging 0.66
R7585:Vmn2r68 UTSW 7 85232379 missense probably damaging 1.00
R7605:Vmn2r68 UTSW 7 85233908 missense probably benign 0.01
R7892:Vmn2r68 UTSW 7 85234514 missense probably benign
R7979:Vmn2r68 UTSW 7 85234417 critical splice donor site probably null
R8177:Vmn2r68 UTSW 7 85222214 nonsense probably null
R8349:Vmn2r68 UTSW 7 85233577 missense probably damaging 1.00
R8378:Vmn2r68 UTSW 7 85221900 missense probably benign 0.00
R8397:Vmn2r68 UTSW 7 85237514 missense possibly damaging 0.71
R8449:Vmn2r68 UTSW 7 85233577 missense probably damaging 1.00
V7581:Vmn2r68 UTSW 7 85221880 missense probably benign 0.01
Z1176:Vmn2r68 UTSW 7 85221733 missense probably damaging 1.00
Z1176:Vmn2r68 UTSW 7 85222081 missense probably benign 0.27
Z1176:Vmn2r68 UTSW 7 85222099 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- AAGCAGCCACCTCATTCTTC -3'
(R):5'- TGTGTGAAGTGTCGAGAAGATC -3'

Sequencing Primer
(F):5'- ATTGTCTTAGCCAAGATAGTAGAGG -3'
(R):5'- TGAAGTGTCGAGAAGATCAATATGC -3'
Posted On2019-06-26