Incidental Mutation 'R7287:Fgf15'
ID566098
Institutional Source Beutler Lab
Gene Symbol Fgf15
Ensembl Gene ENSMUSG00000031073
Gene Namefibroblast growth factor 15
SynonymsFGF19
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7287 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location144896531-144900953 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 144896794 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 39 (D39V)
Ref Sequence ENSEMBL: ENSMUSP00000033389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033389] [ENSMUST00000207229]
Predicted Effect probably benign
Transcript: ENSMUST00000033389
AA Change: D39V

PolyPhen 2 Score 0.274 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000033389
Gene: ENSMUSG00000031073
AA Change: D39V

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
FGF 49 177 1.93e-51 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000207229
AA Change: D39V

PolyPhen 2 Score 0.045 (Sensitivity: 0.94; Specificity: 0.83)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.8%
  • 20x: 99.4%
Validation Efficiency 100% (71/71)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor (FGF) family. FGF family members possess broad mitogenic and cell survival activities, and are involved in a variety of biological processes including embryonic development cell growth, morphogenesis, tissue repair, tumor growth and invasion. This growth factor is a high affinity, heparin dependent ligand for FGFR4. Expression of this gene was detected only in fetal but not adult brain tissue. Synergistic interaction of the chick homolog and Wnt-8c has been shown to be required for initiation of inner ear development. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted inactivation of this gene leads to a severe underrepresentation of homozygotes at weaning as well as highly penetrant ventricular septal defects and malalignment of the aorta and pulmonary trunk. No abnormalities in otic induction or otic vesicle formation are observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2610507B11Rik G A 11: 78,272,883 R1059H possibly damaging Het
Abca3 A G 17: 24,385,887 D656G possibly damaging Het
Abcc3 C T 11: 94,357,047 A1207T probably benign Het
Abcc8 T C 7: 46,113,110 H1209R probably damaging Het
Adam26a T C 8: 43,570,343 T37A possibly damaging Het
Adamts9 C T 6: 92,890,003 R685Q possibly damaging Het
Anapc7 T A 5: 122,433,436 N191K probably benign Het
Ankrd26 C T 6: 118,549,637 probably null Het
Ap5z1 T C 5: 142,474,047 L484P probably damaging Het
Arhgap32 A G 9: 32,152,697 D77G Het
Atp10a T A 7: 58,827,269 D1213E probably damaging Het
B3gnt8 T C 7: 25,628,970 L275P probably damaging Het
Cab39 A G 1: 85,818,461 E21G probably benign Het
Capn15 G T 17: 25,960,455 S948R probably damaging Het
Cbarp T C 10: 80,137,320 T15A unknown Het
Ccdc81 C T 7: 89,893,123 A182T probably damaging Het
Ccpg1 A G 9: 73,015,406 H766R probably benign Het
Cfl1 T C 19: 5,492,534 V14A probably benign Het
Chd6 A G 2: 161,008,392 I875T probably benign Het
Cidec T A 6: 113,428,398 E121D probably benign Het
Clpx C A 9: 65,300,013 Y64* probably null Het
Cntn1 T A 15: 92,245,952 probably null Het
Cyp24a1 A G 2: 170,485,906 L472P probably damaging Het
Dcdc2c G T 12: 28,516,686 D159E probably benign Het
Emp1 T C 6: 135,380,169 F82L probably benign Het
Fem1b T C 9: 62,796,122 T619A probably benign Het
Galnt12 T G 4: 47,108,525 F221V probably damaging Het
Herc6 A G 6: 57,651,980 probably null Het
Hspg2 G A 4: 137,529,556 V1537I probably benign Het
Ido2 T C 8: 24,535,138 probably null Het
Insr G A 8: 3,169,717 T935I probably benign Het
Itgax G A 7: 128,148,505 C1031Y probably damaging Het
Kif13a C T 13: 46,752,455 V671M possibly damaging Het
Kmt5b T C 19: 3,804,501 Y255H possibly damaging Het
Lrriq1 A T 10: 103,216,016 Y292N probably benign Het
Mrpl37 A G 4: 107,060,520 F318S probably damaging Het
Nav2 A G 7: 49,420,328 N311D probably benign Het
Nbeal1 G C 1: 60,237,151 V684L probably benign Het
Nlrp9b T C 7: 20,028,456 C673R probably damaging Het
Npnt A G 3: 132,906,802 V74A probably benign Het
Olfr1335 T A 4: 118,809,742 T41S probably benign Het
Olfr378 T A 11: 73,425,843 I47F probably benign Het
Plce1 A T 19: 38,701,903 Q677L probably benign Het
Pmel C T 10: 128,715,226 Q113* probably null Het
Pom121l2 T A 13: 21,984,332 F924L probably benign Het
Poteg G A 8: 27,453,344 R214K probably null Het
Pprc1 G T 19: 46,071,354 S1480I unknown Het
Secisbp2l A G 2: 125,740,369 S1056P probably benign Het
Selenoo T C 15: 89,098,700 F477L probably benign Het
Senp2 A G 16: 22,018,364 D121G probably damaging Het
Slc25a11 T C 11: 70,645,355 D211G probably benign Het
Slc44a2 A G 9: 21,342,456 D131G probably benign Het
Tcf25 G A 8: 123,373,972 A34T possibly damaging Het
Tm9sf3 A G 19: 41,217,379 Y530H probably damaging Het
Tmco3 G A 8: 13,319,605 probably null Het
Tmem132d G T 5: 127,984,351 Q396K probably damaging Het
Tmem154 A G 3: 84,690,563 T136A possibly damaging Het
Tnrc6b A G 15: 80,879,541 T415A possibly damaging Het
Tonsl T C 15: 76,633,725 probably null Het
Ttyh1 T C 7: 4,125,658 Y185H probably benign Het
Ufl1 T A 4: 25,254,852 T535S probably benign Het
Vmn1r15 T C 6: 57,258,216 L23P possibly damaging Het
Vmn2r25 T A 6: 123,852,081 H78L possibly damaging Het
Vmn2r68 T C 7: 85,222,252 T608A probably benign Het
Vwf A G 6: 125,637,467 I1104V Het
Zbtb2 C T 10: 4,368,986 D347N possibly damaging Het
Zfyve9 A T 4: 108,718,256 S543T probably benign Het
Zhx1 T C 15: 58,053,296 N518S probably damaging Het
Zmym6 T C 4: 127,122,982 V852A possibly damaging Het
Other mutations in Fgf15
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00763:Fgf15 APN 7 144899892 missense probably damaging 1.00
IGL00764:Fgf15 APN 7 144896935 splice site probably null
R1690:Fgf15 UTSW 7 144899928 missense probably damaging 1.00
R2444:Fgf15 UTSW 7 144899692 missense probably benign 0.03
R5073:Fgf15 UTSW 7 144896839 missense possibly damaging 0.94
R6149:Fgf15 UTSW 7 144899769 nonsense probably null
R7396:Fgf15 UTSW 7 144899805 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- CACTGTCGGAGCAGTAACTC -3'
(R):5'- ACGTGCTTCTGGGTCCTAAG -3'

Sequencing Primer
(F):5'- TCGGAGCAGTAACTCTGTGC -3'
(R):5'- GACGGGCTGAATGATACT -3'
Posted On2019-06-26