Mutagenetix > Incidental Mutation

Incidental Mutation 'R7287:Kif13a'

566118

Institutional Source

Beutler Lab

Gene Symbol

Kif13a

Ensembl Gene

ENSMUSG00000021375

Gene Name

kinesin family member 13A

Synonyms

4930505I07Rik, N-3 kinesin

MMRRC Submission

045321-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.268) question?

Stock #

R7287 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

46749087-46929867 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 46752455 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Methionine at position 671 (V671M)

Ref Sequence

ENSEMBL: ENSMUSP00000153657 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056978] [ENSMUST00000223881]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000056978
AA Change: V1619M

PolyPhen 2 Score 0.499 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000055304
Gene: ENSMUSG00000021375
AA Change: V1619M

Domain	Start	End	E-Value	Type
KISc	3	360	2.69e-175	SMART
low complexity region	368	381	N/A	INTRINSIC
low complexity region	391	406	N/A	INTRINSIC
FHA	469	519	7.16e-2	SMART
coiled coil region	605	639	N/A	INTRINSIC
coiled coil region	664	704	N/A	INTRINSIC
Pfam:KIF1B	748	792	1.7e-19	PFAM
low complexity region	840	854	N/A	INTRINSIC
low complexity region	903	915	N/A	INTRINSIC
Pfam:DUF3694	1003	1270	2.2e-39	PFAM
low complexity region	1401	1412	N/A	INTRINSIC
low complexity region	1475	1492	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000223881
AA Change: V671M

PolyPhen 2 Score 0.949 (Sensitivity: 0.79; Specificity: 0.95)

Predicted Effect

Meta Mutation Damage Score

0.0761

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

100% (71/71)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the kinesin family of microtubule-based motor proteins that function in the positioning of endosomes. This family member can direct mannose-6-phosphate receptor-containing vesicles from the trans-Golgi network to the plasma membrane, and it is necessary for the steady-state distribution of late endosomes/lysosomes. It is also required for the translocation of FYVE-CENT and TTC19 from the centrosome to the midbody during cytokinesis, and it plays a role in melanosome maturation. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased anxiety. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	G	A	11: 78,272,883	R1059H	possibly damaging	Het
Abca3	A	G	17: 24,385,887	D656G	possibly damaging	Het
Abcc3	C	T	11: 94,357,047	A1207T	probably benign	Het
Abcc8	T	C	7: 46,113,110	H1209R	probably damaging	Het
Adam26a	T	C	8: 43,570,343	T37A	possibly damaging	Het
Adamts9	C	T	6: 92,890,003	R685Q	possibly damaging	Het
Anapc7	T	A	5: 122,433,436	N191K	probably benign	Het
Ankrd26	C	T	6: 118,549,637		probably null	Het
Ap5z1	T	C	5: 142,474,047	L484P	probably damaging	Het
Arhgap32	A	G	9: 32,152,697	D77G		Het
Atp10a	T	A	7: 58,827,269	D1213E	probably damaging	Het
B3gnt8	T	C	7: 25,628,970	L275P	probably damaging	Het
Cab39	A	G	1: 85,818,461	E21G	probably benign	Het
Capn15	G	T	17: 25,960,455	S948R	probably damaging	Het
Cbarp	T	C	10: 80,137,320	T15A	unknown	Het
Ccdc81	C	T	7: 89,893,123	A182T	probably damaging	Het
Ccpg1	A	G	9: 73,015,406	H766R	probably benign	Het
Cfl1	T	C	19: 5,492,534	V14A	probably benign	Het
Chd6	A	G	2: 161,008,392	I875T	probably benign	Het
Cidec	T	A	6: 113,428,398	E121D	probably benign	Het
Clpx	C	A	9: 65,300,013	Y64*	probably null	Het
Cntn1	T	A	15: 92,245,952		probably null	Het
Cyp24a1	A	G	2: 170,485,906	L472P	probably damaging	Het
Dcdc2c	G	T	12: 28,516,686	D159E	probably benign	Het
Emp1	T	C	6: 135,380,169	F82L	probably benign	Het
Fem1b	T	C	9: 62,796,122	T619A	probably benign	Het
Fgf15	A	T	7: 144,896,794	D39V	probably benign	Het
Galnt12	T	G	4: 47,108,525	F221V	probably damaging	Het
Herc6	A	G	6: 57,651,980		probably null	Het
Hspg2	G	A	4: 137,529,556	V1537I	probably benign	Het
Ido2	T	C	8: 24,535,138		probably null	Het
Insr	G	A	8: 3,169,717	T935I	probably benign	Het
Itgax	G	A	7: 128,148,505	C1031Y	probably damaging	Het
Kmt5b	T	C	19: 3,804,501	Y255H	possibly damaging	Het
Lrriq1	A	T	10: 103,216,016	Y292N	probably benign	Het
Mrpl37	A	G	4: 107,060,520	F318S	probably damaging	Het
Nav2	A	G	7: 49,420,328	N311D	probably benign	Het
Nbeal1	G	C	1: 60,237,151	V684L	probably benign	Het
Nlrp9b	T	C	7: 20,028,456	C673R	probably damaging	Het
Npnt	A	G	3: 132,906,802	V74A	probably benign	Het
Olfr1335	T	A	4: 118,809,742	T41S	probably benign	Het
Olfr378	T	A	11: 73,425,843	I47F	probably benign	Het
Plce1	A	T	19: 38,701,903	Q677L	probably benign	Het
Pmel	C	T	10: 128,715,226	Q113*	probably null	Het
Pom121l2	T	A	13: 21,984,332	F924L	probably benign	Het
Poteg	G	A	8: 27,453,344	R214K	probably null	Het
Pprc1	G	T	19: 46,071,354	S1480I	unknown	Het
Secisbp2l	A	G	2: 125,740,369	S1056P	probably benign	Het
Selenoo	T	C	15: 89,098,700	F477L	probably benign	Het
Senp2	A	G	16: 22,018,364	D121G	probably damaging	Het
Slc25a11	T	C	11: 70,645,355	D211G	probably benign	Het
Slc44a2	A	G	9: 21,342,456	D131G	probably benign	Het
Tcf25	G	A	8: 123,373,972	A34T	possibly damaging	Het
Tm9sf3	A	G	19: 41,217,379	Y530H	probably damaging	Het
Tmco3	G	A	8: 13,319,605		probably null	Het
Tmem132d	G	T	5: 127,984,351	Q396K	probably damaging	Het
Tmem154	A	G	3: 84,690,563	T136A	possibly damaging	Het
Tnrc6b	A	G	15: 80,879,541	T415A	possibly damaging	Het
Tonsl	T	C	15: 76,633,725		probably null	Het
Ttyh1	T	C	7: 4,125,658	Y185H	probably benign	Het
Ufl1	T	A	4: 25,254,852	T535S	probably benign	Het
Vmn1r15	T	C	6: 57,258,216	L23P	possibly damaging	Het
Vmn2r25	T	A	6: 123,852,081	H78L	possibly damaging	Het
Vmn2r68	T	C	7: 85,222,252	T608A	probably benign	Het
Vwf	A	G	6: 125,637,467	I1104V		Het
Zbtb2	C	T	10: 4,368,986	D347N	possibly damaging	Het
Zfyve9	A	T	4: 108,718,256	S543T	probably benign	Het
Zhx1	T	C	15: 58,053,296	N518S	probably damaging	Het
Zmym6	T	C	4: 127,122,982	V852A	possibly damaging	Het

Other mutations in Kif13a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01084:Kif13a	APN	13	46750634	splice site	probably benign
IGL01433:Kif13a	APN	13	46772908	missense	probably damaging	1.00
IGL01528:Kif13a	APN	13	46864837	splice site	probably benign
IGL01536:Kif13a	APN	13	46752289	missense	probably damaging	0.96
IGL01620:Kif13a	APN	13	46864820	missense	probably benign
IGL02020:Kif13a	APN	13	46794019	missense	probably benign	0.05
IGL02142:Kif13a	APN	13	46771535	missense	probably benign	0.04
IGL02375:Kif13a	APN	13	46825222	missense	probably damaging	1.00
IGL02407:Kif13a	APN	13	46785293	missense	probably damaging	0.99
IGL02476:Kif13a	APN	13	46785296	missense	probably damaging	1.00
IGL03038:Kif13a	APN	13	46772838	missense	probably damaging	1.00
IGL03053:Kif13a	APN	13	46752088	missense	probably benign	0.01
IGL03366:Kif13a	APN	13	46764623	missense	probably benign	0.00
R0025:Kif13a	UTSW	13	46786511	critical splice donor site	probably null
R0106:Kif13a	UTSW	13	46825347	splice site	probably benign
R0106:Kif13a	UTSW	13	46825347	splice site	probably benign
R0135:Kif13a	UTSW	13	46793943	missense	probably damaging	0.99
R0137:Kif13a	UTSW	13	46764603	missense	probably benign	0.38
R0243:Kif13a	UTSW	13	46791351	missense	probably benign	0.24
R0346:Kif13a	UTSW	13	46814219	missense	possibly damaging	0.95
R0403:Kif13a	UTSW	13	46791401	missense	probably damaging	1.00
R0492:Kif13a	UTSW	13	46812742	missense	possibly damaging	0.93
R0607:Kif13a	UTSW	13	46802711	missense	probably damaging	0.96
R0631:Kif13a	UTSW	13	46778888	unclassified	probably benign
R0654:Kif13a	UTSW	13	46812742	missense	possibly damaging	0.93
R0697:Kif13a	UTSW	13	46848337	missense	probably benign	0.19
R0699:Kif13a	UTSW	13	46799213	missense	possibly damaging	0.92
R0715:Kif13a	UTSW	13	46812823	missense	probably damaging	0.98
R0834:Kif13a	UTSW	13	46814236	missense	probably damaging	0.96
R0903:Kif13a	UTSW	13	46929259	missense	possibly damaging	0.75
R1419:Kif13a	UTSW	13	46825235	missense	probably damaging	1.00
R1428:Kif13a	UTSW	13	46791511	splice site	probably benign
R1449:Kif13a	UTSW	13	46812736	missense	probably damaging	1.00
R1463:Kif13a	UTSW	13	46929612	missense	possibly damaging	0.75
R1541:Kif13a	UTSW	13	46809213	missense	probably benign
R1579:Kif13a	UTSW	13	46752856	missense	possibly damaging	0.93
R1582:Kif13a	UTSW	13	46793922	missense	probably benign	0.03
R1644:Kif13a	UTSW	13	46793922	missense	probably benign	0.31
R1752:Kif13a	UTSW	13	46798409	missense	probably damaging	1.00
R1755:Kif13a	UTSW	13	46752613	missense	possibly damaging	0.73
R1755:Kif13a	UTSW	13	46773678	missense	possibly damaging	0.50
R1858:Kif13a	UTSW	13	46864838	splice site	probably benign
R1891:Kif13a	UTSW	13	46929219	missense	possibly damaging	0.63
R1902:Kif13a	UTSW	13	46788162	missense	probably benign	0.00
R1928:Kif13a	UTSW	13	46812745	missense	probably damaging	1.00
R1960:Kif13a	UTSW	13	46864838	splice site	probably benign
R1961:Kif13a	UTSW	13	46864838	splice site	probably benign
R2016:Kif13a	UTSW	13	46810799	missense	probably benign	0.13
R2139:Kif13a	UTSW	13	46752469	missense	possibly damaging	0.92
R2174:Kif13a	UTSW	13	46769176	missense	probably damaging	0.99
R2407:Kif13a	UTSW	13	46777097	missense	probably damaging	1.00
R2504:Kif13a	UTSW	13	46814200	missense	probably damaging	1.00
R3122:Kif13a	UTSW	13	46764596	splice site	probably benign
R3499:Kif13a	UTSW	13	46825339	missense	probably damaging	1.00
R3905:Kif13a	UTSW	13	46802690	missense	probably damaging	1.00
R4474:Kif13a	UTSW	13	46814155	splice site	probably null
R4771:Kif13a	UTSW	13	46825211	missense	probably damaging	1.00
R4838:Kif13a	UTSW	13	46826748	missense	probably damaging	1.00
R4924:Kif13a	UTSW	13	46929599	missense	probably damaging	1.00
R4931:Kif13a	UTSW	13	46809055	missense	probably damaging	0.96
R4980:Kif13a	UTSW	13	46752746	missense	possibly damaging	0.76
R4992:Kif13a	UTSW	13	46777163	missense	probably damaging	0.96
R5047:Kif13a	UTSW	13	46788085	missense	probably benign	0.00
R5054:Kif13a	UTSW	13	46802646	missense	probably damaging	1.00
R5141:Kif13a	UTSW	13	46752721	missense	probably benign
R5329:Kif13a	UTSW	13	46775401	critical splice donor site	probably null
R5429:Kif13a	UTSW	13	46772769	critical splice donor site	probably null
R5499:Kif13a	UTSW	13	46832736	missense	probably damaging	1.00
R5509:Kif13a	UTSW	13	46752115	missense	probably benign	0.13
R5594:Kif13a	UTSW	13	46752862	missense	probably damaging	1.00
R5921:Kif13a	UTSW	13	46825300	missense	probably damaging	1.00
R5964:Kif13a	UTSW	13	46771524	missense	probably damaging	1.00
R6115:Kif13a	UTSW	13	46801313	missense	probably damaging	1.00
R6317:Kif13a	UTSW	13	46826757	missense	probably damaging	1.00
R6318:Kif13a	UTSW	13	46815207	splice site	probably null
R6393:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R6394:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R6395:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R6735:Kif13a	UTSW	13	46752746	missense	possibly damaging	0.76
R7037:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R7038:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R7039:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R7237:Kif13a	UTSW	13	46809156	critical splice donor site	probably null
R7285:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R7286:Kif13a	UTSW	13	46752455	missense	possibly damaging	0.95
R7341:Kif13a	UTSW	13	46826745	missense	probably damaging	1.00
R7693:Kif13a	UTSW	13	46750613	missense	probably benign	0.01
R7761:Kif13a	UTSW	13	46798479	missense	probably benign
R8098:Kif13a	UTSW	13	46815304	missense	probably damaging	1.00
R8171:Kif13a	UTSW	13	46778968	missense	probably damaging	1.00
R8271:Kif13a	UTSW	13	46752581	missense	probably benign	0.01
R8806:Kif13a	UTSW	13	46761337	missense	possibly damaging	0.49
R8871:Kif13a	UTSW	13	46830803	missense	probably damaging	1.00
R8877:Kif13a	UTSW	13	46801445	critical splice acceptor site	probably null
R8906:Kif13a	UTSW	13	46773678	missense	probably benign	0.17
R9028:Kif13a	UTSW	13	46798365	missense	probably damaging	1.00
R9058:Kif13a	UTSW	13	46791465	missense	probably damaging	1.00
R9062:Kif13a	UTSW	13	46788060	missense	possibly damaging	0.91
R9070:Kif13a	UTSW	13	46752458	missense	probably benign	0.00
R9083:Kif13a	UTSW	13	46812787	missense	probably damaging	1.00
R9250:Kif13a	UTSW	13	46775433	missense	probably damaging	1.00
R9328:Kif13a	UTSW	13	46798362	missense	probably damaging	1.00
R9360:Kif13a	UTSW	13	46808996	missense	probably benign	0.01
R9369:Kif13a	UTSW	13	46786623	missense	probably damaging	0.99
R9589:Kif13a	UTSW	13	46802544	missense	probably benign	0.01
R9749:Kif13a	UTSW	13	46760751	missense	probably damaging	0.96
X0013:Kif13a	UTSW	13	46929270	missense	possibly damaging	0.49

Predicted Primers

PCR Primer
(F):5'- ATGAACTCTGTGAAGGAATGGTC -3'
(R):5'- ATGCCACTCTGTCTGACATGG -3'

Sequencing Primer
(F):5'- CCTCCAAAATGTTTGTAGTGTGTTC -3'
(R):5'- ACTCTGTCTGACATGGCAGTC -3'

Posted On

2019-06-26