Mutagenetix > Incidental Mutation

Incidental Mutation 'R7287:Tnrc6b'

566120

Institutional Source

Beutler Lab

Gene Symbol

Tnrc6b

Ensembl Gene

ENSMUSG00000047888

Gene Name

trinucleotide repeat containing 6b

Synonyms

MMRRC Submission

045321-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.175) question?

Stock #

R7287 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

80711313-80941085 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 80879541 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 415 (T415A)

Ref Sequence

ENSEMBL: ENSMUSP00000064336 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000067689]

AlphaFold

Q8BKI2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000067689
AA Change: T415A

PolyPhen 2 Score 0.832 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000064336
Gene: ENSMUSG00000047888
AA Change: T415A

Domain	Start	End	E-Value	Type
low complexity region	7	19	N/A	INTRINSIC
coiled coil region	33	72	N/A	INTRINSIC
low complexity region	88	106	N/A	INTRINSIC
low complexity region	155	174	N/A	INTRINSIC
low complexity region	207	220	N/A	INTRINSIC
low complexity region	242	260	N/A	INTRINSIC
low complexity region	331	346	N/A	INTRINSIC
low complexity region	363	380	N/A	INTRINSIC
low complexity region	416	425	N/A	INTRINSIC
low complexity region	475	487	N/A	INTRINSIC
internal_repeat_1	488	667	6.43e-5	PROSPERO
low complexity region	858	888	N/A	INTRINSIC
Pfam:Ago_hook	955	1095	1.2e-28	PFAM
coiled coil region	1258	1307	N/A	INTRINSIC
Pfam:TNRC6-PABC_bdg	1339	1623	2.8e-112	PFAM
Pfam:RRM_5	1641	1695	2e-7	PFAM
low complexity region	1705	1721	N/A	INTRINSIC
low complexity region	1748	1769	N/A	INTRINSIC
low complexity region	1792	1809	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000228124

Coding Region Coverage

1x: 100.0%
3x: 100.0%
10x: 99.8%
20x: 99.4%

Validation Efficiency

100% (71/71)

MGI Phenotype

PHENOTYPE: Mice homozygous for a gene trap allele exhibit neonatal and postnatal lethality with decreased body weight and infertility. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 69 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2610507B11Rik	G	A	11: 78,272,883	R1059H	possibly damaging	Het
Abca3	A	G	17: 24,385,887	D656G	possibly damaging	Het
Abcc3	C	T	11: 94,357,047	A1207T	probably benign	Het
Abcc8	T	C	7: 46,113,110	H1209R	probably damaging	Het
Adam26a	T	C	8: 43,570,343	T37A	possibly damaging	Het
Adamts9	C	T	6: 92,890,003	R685Q	possibly damaging	Het
Anapc7	T	A	5: 122,433,436	N191K	probably benign	Het
Ankrd26	C	T	6: 118,549,637		probably null	Het
Ap5z1	T	C	5: 142,474,047	L484P	probably damaging	Het
Arhgap32	A	G	9: 32,152,697	D77G		Het
Atp10a	T	A	7: 58,827,269	D1213E	probably damaging	Het
B3gnt8	T	C	7: 25,628,970	L275P	probably damaging	Het
Cab39	A	G	1: 85,818,461	E21G	probably benign	Het
Capn15	G	T	17: 25,960,455	S948R	probably damaging	Het
Cbarp	T	C	10: 80,137,320	T15A	unknown	Het
Ccdc81	C	T	7: 89,893,123	A182T	probably damaging	Het
Ccpg1	A	G	9: 73,015,406	H766R	probably benign	Het
Cfl1	T	C	19: 5,492,534	V14A	probably benign	Het
Chd6	A	G	2: 161,008,392	I875T	probably benign	Het
Cidec	T	A	6: 113,428,398	E121D	probably benign	Het
Clpx	C	A	9: 65,300,013	Y64*	probably null	Het
Cntn1	T	A	15: 92,245,952		probably null	Het
Cyp24a1	A	G	2: 170,485,906	L472P	probably damaging	Het
Dcdc2c	G	T	12: 28,516,686	D159E	probably benign	Het
Emp1	T	C	6: 135,380,169	F82L	probably benign	Het
Fem1b	T	C	9: 62,796,122	T619A	probably benign	Het
Fgf15	A	T	7: 144,896,794	D39V	probably benign	Het
Galnt12	T	G	4: 47,108,525	F221V	probably damaging	Het
Herc6	A	G	6: 57,651,980		probably null	Het
Hspg2	G	A	4: 137,529,556	V1537I	probably benign	Het
Ido2	T	C	8: 24,535,138		probably null	Het
Insr	G	A	8: 3,169,717	T935I	probably benign	Het
Itgax	G	A	7: 128,148,505	C1031Y	probably damaging	Het
Kif13a	C	T	13: 46,752,455	V671M	possibly damaging	Het
Kmt5b	T	C	19: 3,804,501	Y255H	possibly damaging	Het
Lrriq1	A	T	10: 103,216,016	Y292N	probably benign	Het
Mrpl37	A	G	4: 107,060,520	F318S	probably damaging	Het
Nav2	A	G	7: 49,420,328	N311D	probably benign	Het
Nbeal1	G	C	1: 60,237,151	V684L	probably benign	Het
Nlrp9b	T	C	7: 20,028,456	C673R	probably damaging	Het
Npnt	A	G	3: 132,906,802	V74A	probably benign	Het
Olfr1335	T	A	4: 118,809,742	T41S	probably benign	Het
Olfr378	T	A	11: 73,425,843	I47F	probably benign	Het
Plce1	A	T	19: 38,701,903	Q677L	probably benign	Het
Pmel	C	T	10: 128,715,226	Q113*	probably null	Het
Pom121l2	T	A	13: 21,984,332	F924L	probably benign	Het
Poteg	G	A	8: 27,453,344	R214K	probably null	Het
Pprc1	G	T	19: 46,071,354	S1480I	unknown	Het
Secisbp2l	A	G	2: 125,740,369	S1056P	probably benign	Het
Selenoo	T	C	15: 89,098,700	F477L	probably benign	Het
Senp2	A	G	16: 22,018,364	D121G	probably damaging	Het
Slc25a11	T	C	11: 70,645,355	D211G	probably benign	Het
Slc44a2	A	G	9: 21,342,456	D131G	probably benign	Het
Tcf25	G	A	8: 123,373,972	A34T	possibly damaging	Het
Tm9sf3	A	G	19: 41,217,379	Y530H	probably damaging	Het
Tmco3	G	A	8: 13,319,605		probably null	Het
Tmem132d	G	T	5: 127,984,351	Q396K	probably damaging	Het
Tmem154	A	G	3: 84,690,563	T136A	possibly damaging	Het
Tonsl	T	C	15: 76,633,725		probably null	Het
Ttyh1	T	C	7: 4,125,658	Y185H	probably benign	Het
Ufl1	T	A	4: 25,254,852	T535S	probably benign	Het
Vmn1r15	T	C	6: 57,258,216	L23P	possibly damaging	Het
Vmn2r25	T	A	6: 123,852,081	H78L	possibly damaging	Het
Vmn2r68	T	C	7: 85,222,252	T608A	probably benign	Het
Vwf	A	G	6: 125,637,467	I1104V		Het
Zbtb2	C	T	10: 4,368,986	D347N	possibly damaging	Het
Zfyve9	A	T	4: 108,718,256	S543T	probably benign	Het
Zhx1	T	C	15: 58,053,296	N518S	probably damaging	Het
Zmym6	T	C	4: 127,122,982	V852A	possibly damaging	Het

Other mutations in Tnrc6b

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01312:Tnrc6b	APN	15	80923578	missense	probably damaging	1.00
IGL01402:Tnrc6b	APN	15	80880544	missense	possibly damaging	0.71
IGL01505:Tnrc6b	APN	15	80879963	missense	probably benign	0.00
IGL01516:Tnrc6b	APN	15	80902622	missense	possibly damaging	0.93
IGL01584:Tnrc6b	APN	15	80879682	missense	probably benign	0.01
IGL01681:Tnrc6b	APN	15	80879311	splice site	probably null
IGL01909:Tnrc6b	APN	15	80901983	missense	possibly damaging	0.88
IGL01943:Tnrc6b	APN	15	80927695	nonsense	probably null
IGL02253:Tnrc6b	APN	15	80876541	missense	probably damaging	0.99
IGL02260:Tnrc6b	APN	15	80880171	missense	probably damaging	0.99
IGL02437:Tnrc6b	APN	15	80880457	missense	probably damaging	1.00
IGL02541:Tnrc6b	APN	15	80879831	missense	probably benign	0.00
IGL02542:Tnrc6b	APN	15	80902352	missense	possibly damaging	0.83
grosser	UTSW	15	80929285	missense	probably damaging	1.00
heiliger	UTSW	15	80927741	critical splice donor site	probably null
PIT1430001:Tnrc6b	UTSW	15	80929186	missense	probably damaging	0.99
R0092:Tnrc6b	UTSW	15	80918528	missense	probably damaging	1.00
R0165:Tnrc6b	UTSW	15	80858670	splice site	probably null
R0238:Tnrc6b	UTSW	15	80887864	missense	probably damaging	1.00
R0238:Tnrc6b	UTSW	15	80887864	missense	probably damaging	1.00
R0257:Tnrc6b	UTSW	15	80894355	missense	possibly damaging	0.80
R0418:Tnrc6b	UTSW	15	80913323	missense	probably benign	0.27
R0432:Tnrc6b	UTSW	15	80923446	splice site	probably benign
R0487:Tnrc6b	UTSW	15	80880675	missense	probably benign	0.01
R0498:Tnrc6b	UTSW	15	80858719	missense	probably damaging	0.98
R0528:Tnrc6b	UTSW	15	80879403	missense	probably benign	0.00
R0533:Tnrc6b	UTSW	15	80876653	missense	probably benign	0.00
R0571:Tnrc6b	UTSW	15	80913338	missense	probably damaging	1.00
R0650:Tnrc6b	UTSW	15	80784758	missense	probably benign	0.33
R0659:Tnrc6b	UTSW	15	80923446	splice site	probably benign
R0884:Tnrc6b	UTSW	15	80902555	small deletion	probably benign
R1131:Tnrc6b	UTSW	15	80894453	missense	possibly damaging	0.45
R1188:Tnrc6b	UTSW	15	80879229	missense	probably benign
R1479:Tnrc6b	UTSW	15	80887032	splice site	probably null
R1564:Tnrc6b	UTSW	15	80880168	missense	possibly damaging	0.95
R1645:Tnrc6b	UTSW	15	80882958	missense	probably damaging	0.99
R1924:Tnrc6b	UTSW	15	80884206	critical splice acceptor site	probably null
R1926:Tnrc6b	UTSW	15	80881162	missense	probably damaging	1.00
R1928:Tnrc6b	UTSW	15	80880723	missense	probably damaging	1.00
R1965:Tnrc6b	UTSW	15	80880439	missense	probably damaging	1.00
R1966:Tnrc6b	UTSW	15	80880439	missense	probably damaging	1.00
R2072:Tnrc6b	UTSW	15	80882965	missense	possibly damaging	0.89
R3084:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R3552:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R3736:Tnrc6b	UTSW	15	80889163	splice site	probably benign
R3791:Tnrc6b	UTSW	15	80923640	missense	probably damaging	1.00
R4170:Tnrc6b	UTSW	15	80916787	missense	probably benign	0.24
R4276:Tnrc6b	UTSW	15	80901971	missense	probably benign	0.42
R4519:Tnrc6b	UTSW	15	80880247	missense	probably damaging	1.00
R5380:Tnrc6b	UTSW	15	80879565	missense	possibly damaging	0.56
R5470:Tnrc6b	UTSW	15	80916711	missense	possibly damaging	0.89
R5590:Tnrc6b	UTSW	15	80876502	missense	probably damaging	0.98
R5982:Tnrc6b	UTSW	15	80880816	missense	probably benign
R6269:Tnrc6b	UTSW	15	80880743	missense	probably benign	0.42
R6331:Tnrc6b	UTSW	15	80879614	missense	probably benign	0.00
R6484:Tnrc6b	UTSW	15	80879324	missense	possibly damaging	0.92
R6622:Tnrc6b	UTSW	15	80879184	missense	probably damaging	0.99
R6695:Tnrc6b	UTSW	15	80879773	missense	probably damaging	1.00
R6728:Tnrc6b	UTSW	15	80918526	missense	probably damaging	1.00
R6776:Tnrc6b	UTSW	15	80924119	missense	possibly damaging	0.87
R7159:Tnrc6b	UTSW	15	80887022	missense	possibly damaging	0.92
R7210:Tnrc6b	UTSW	15	80929285	missense	probably damaging	1.00
R7402:Tnrc6b	UTSW	15	80884300	missense	probably damaging	1.00
R7479:Tnrc6b	UTSW	15	80889126	missense	probably benign	0.13
R7533:Tnrc6b	UTSW	15	80927741	critical splice donor site	probably null
R7571:Tnrc6b	UTSW	15	80929393	missense	probably benign
R7594:Tnrc6b	UTSW	15	80880307	missense	possibly damaging	0.66
R7831:Tnrc6b	UTSW	15	80880379	missense	possibly damaging	0.49
R8208:Tnrc6b	UTSW	15	80858700	missense	possibly damaging	0.53
R8276:Tnrc6b	UTSW	15	80880717	missense	probably benign	0.00
R8295:Tnrc6b	UTSW	15	80913364	missense	probably damaging	1.00
R8351:Tnrc6b	UTSW	15	80923490	missense	probably damaging	0.99
R8423:Tnrc6b	UTSW	15	80929418	missense	unknown
R8451:Tnrc6b	UTSW	15	80923490	missense	probably damaging	0.99
R8725:Tnrc6b	UTSW	15	80876452	missense	probably damaging	1.00
R8872:Tnrc6b	UTSW	15	80918089	missense	probably benign	0.23
R9029:Tnrc6b	UTSW	15	80878978	missense	possibly damaging	0.83
R9057:Tnrc6b	UTSW	15	80879148	missense	probably benign
R9240:Tnrc6b	UTSW	15	80880061	missense	probably damaging	0.98
R9450:Tnrc6b	UTSW	15	80880436	missense	probably benign	0.01
R9539:Tnrc6b	UTSW	15	80876343	missense	probably damaging	0.99
R9646:Tnrc6b	UTSW	15	80889065	missense	possibly damaging	0.89
X0020:Tnrc6b	UTSW	15	80882997	missense	probably benign	0.16
X0025:Tnrc6b	UTSW	15	80881167	missense	probably benign	0.03
Z1088:Tnrc6b	UTSW	15	80927690	nonsense	probably null
Z1177:Tnrc6b	UTSW	15	80858699	missense	possibly damaging	0.68

Predicted Primers

PCR Primer
(F):5'- AATAGCAACCCATCTGCCTG -3'
(R):5'- CAGAGACTGTGTCAGTTCCAG -3'

Sequencing Primer
(F):5'- ATCTGCCTGGCCAGCATTG -3'
(R):5'- ACTGTGTCAGTTCCAGAAGGC -3'

Posted On

2019-06-26