Incidental Mutation 'R7288:Plxna2'
ID 566134
Institutional Source Beutler Lab
Gene Symbol Plxna2
Ensembl Gene ENSMUSG00000026640
Gene Name plexin A2
Synonyms 2810428A13Rik, OCT, PlexA2, Plxn2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7288 (G1)
Quality Score 225.009
Status Not validated
Chromosome 1
Chromosomal Location 194618218-194816869 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 194796919 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Leucine to Histidine at position 1296 (L1296H)
Ref Sequence ENSEMBL: ENSMUSP00000027952 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027952]
AlphaFold P70207
PDB Structure Plexin A2 / Semaphorin 6A complex [X-RAY DIFFRACTION]
Mouse Plexin A2 extracellular domain [X-RAY DIFFRACTION]
Mouse Plexin A2, extracellular domains 1-4 [X-RAY DIFFRACTION]
Plexin A2 in complex with Semaphorin 6A [X-RAY DIFFRACTION]
Complex of mouse Plexin A2 - Semaphorin 3A - Neuropilin-1 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000027952
AA Change: L1296H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000027952
Gene: ENSMUSG00000026640
AA Change: L1296H

DomainStartEndE-ValueType
low complexity region 16 29 N/A INTRINSIC
Sema 50 492 1.65e-132 SMART
PSI 510 560 8e-12 SMART
PSI 655 702 6.35e-6 SMART
PSI 803 856 1.24e-8 SMART
IPT 857 952 6.36e-21 SMART
IPT 953 1038 1.02e-24 SMART
IPT 1040 1140 1.48e-21 SMART
IPT 1142 1237 8.81e-6 SMART
transmembrane domain 1238 1260 N/A INTRINSIC
Pfam:Plexin_cytopl 1311 1864 1.9e-261 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the plexin-A family of semaphorin co-receptors. Semaphorins are a large family of secreted or membrane-bound proteins that mediate repulsive effects on axon pathfinding during nervous system development. A subset of semaphorins are recognized by plexin-A/neuropilin transmembrane receptor complexes, triggering a cellular signal transduction cascade that leads to axon repulsion. This plexin-A family member is thought to transduce signals from semaphorin-3A and -3C. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele show abnormal granule cell migration in the adult cerebellum and aberrant projection of mossy fibers in hippocampal slices. Mice homozygous for an ENU-induced allele are smaller and show granule cell migration defects and mild ataxia with incomplete penetrance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T A 11: 58,880,305 D204E probably benign Het
Adh1 T G 3: 138,282,732 D155E probably benign Het
Akt1s1 T C 7: 44,849,147 L2P unknown Het
Ash1l T A 3: 88,965,892 probably benign Het
Bend7 C T 2: 4,752,830 P228S probably damaging Het
Bpifc T C 10: 85,988,721 E218G possibly damaging Het
Cdk6 T A 5: 3,429,001 F127Y probably benign Het
Cgnl1 A T 9: 71,725,564 H168Q possibly damaging Het
Chd7 C T 4: 8,847,093 T1612I possibly damaging Het
Col4a4 A T 1: 82,492,463 C782S unknown Het
Copg2 T A 6: 30,824,406 I364L probably damaging Het
Crygb A G 1: 65,081,925 L81P probably benign Het
Cyp4f18 A T 8: 71,993,173 M326K probably damaging Het
Dhx34 A G 7: 16,215,436 S356P probably benign Het
Dmbt1 C T 7: 131,083,789 Q855* probably null Het
Dnph1 A G 17: 46,499,012 N160S probably benign Het
Esrra A T 19: 6,912,771 C228* probably null Het
Evpl T C 11: 116,223,949 N972D probably benign Het
Fat3 T C 9: 15,998,592 D2038G probably damaging Het
Fhit T A 14: 9,763,784 R102W probably damaging Het
Gal3st1 A T 11: 3,998,609 D272V probably damaging Het
Gal3st1 T A 11: 3,998,651 V286D probably damaging Het
Gemin4 A T 11: 76,213,380 M185K possibly damaging Het
Hecw1 T C 13: 14,316,236 I311V probably benign Het
Ift172 T C 5: 31,285,286 Y179C probably damaging Het
Ighv7-3 C T 12: 114,153,343 W66* probably null Het
Iqgap3 T A 3: 88,108,835 I975N probably damaging Het
Khdrbs3 A G 15: 69,049,413 E281G possibly damaging Het
Lamb2 A T 9: 108,488,324 T1369S probably benign Het
Mettl8 A T 2: 70,982,038 D84E probably benign Het
Mrgprb3 C A 7: 48,643,311 C164F probably damaging Het
Mtg2 A G 2: 180,083,387 Y131C probably damaging Het
Nacc1 C T 8: 84,676,545 A234T probably benign Het
Nsmaf C T 4: 6,416,641 V551I probably benign Het
Olfr541 T A 7: 140,705,029 C259* probably null Het
Olfr869 T A 9: 20,137,441 Y108* probably null Het
Oxr1 C T 15: 41,813,608 P187L not run Het
Pcdhb12 T A 18: 37,436,015 D71E probably benign Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Pkm A G 9: 59,668,913 S127G probably benign Het
Ppil6 C G 10: 41,498,528 T135R probably benign Het
Ppp2r3a T C 9: 101,127,004 Y378C probably damaging Het
Rabep2 C T 7: 126,444,205 R426C probably damaging Het
Rad21 A T 15: 51,982,580 H31Q possibly damaging Het
Rad50 G T 11: 53,654,949 Y1182* probably null Het
Serpinb9c C T 13: 33,151,900 A218T possibly damaging Het
Slc17a2 C A 13: 23,819,112 H248Q probably benign Het
Slc45a4 C A 15: 73,586,936 E255* probably null Het
Slc8a3 T A 12: 81,216,824 K596N possibly damaging Het
Tbc1d32 A C 10: 56,051,387 probably null Het
Tbl2 T A 5: 135,154,399 I112N possibly damaging Het
Tchp A C 5: 114,715,569 K238T probably damaging Het
Tfap2d G A 1: 19,118,983 G251D probably damaging Het
Thrb T A 14: 18,030,186 M324K probably damaging Het
Tmem259 A T 10: 79,978,466 L328Q probably damaging Het
Tmtc2 T C 10: 105,413,608 H88R probably damaging Het
Tnfrsf21 A G 17: 43,037,818 H107R possibly damaging Het
Trib1 T C 15: 59,654,622 V347A probably benign Het
Ung T A 5: 114,131,254 L9* probably null Het
Vmn1r195 G T 13: 22,279,004 V215F probably damaging Het
Wdr63 T C 3: 146,081,252 T343A probably damaging Het
Wdr90 A G 17: 25,846,312 S1657P probably benign Het
Wdsub1 A T 2: 59,878,143 Y129N possibly damaging Het
Zfp369 T G 13: 65,285,018 probably null Het
Zfp770 G T 2: 114,195,661 C642* probably null Het
Zfp981 C T 4: 146,537,643 R342C probably benign Het
Zhx3 A C 2: 160,781,122 V375G probably damaging Het
Other mutations in Plxna2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00227:Plxna2 APN 1 194644657 missense probably damaging 1.00
IGL00332:Plxna2 APN 1 194789830 missense probably damaging 0.98
IGL00392:Plxna2 APN 1 194800568 missense probably damaging 1.00
IGL00432:Plxna2 APN 1 194644096 missense probably benign 0.03
IGL00704:Plxna2 APN 1 194751461 missense probably damaging 0.99
IGL00737:Plxna2 APN 1 194746239 splice site probably benign
IGL01078:Plxna2 APN 1 194786693 unclassified probably benign
IGL01354:Plxna2 APN 1 194762435 missense probably benign 0.02
IGL01432:Plxna2 APN 1 194644318 missense possibly damaging 0.58
IGL01459:Plxna2 APN 1 194764570 missense probably benign 0.00
IGL01525:Plxna2 APN 1 194712311 missense probably benign 0.00
IGL01656:Plxna2 APN 1 194790161 missense possibly damaging 0.52
IGL01825:Plxna2 APN 1 194788902 missense probably damaging 0.98
IGL01862:Plxna2 APN 1 194643950 missense possibly damaging 0.87
IGL01899:Plxna2 APN 1 194751488 missense probably damaging 1.00
IGL01996:Plxna2 APN 1 194799776 missense probably damaging 0.99
IGL02123:Plxna2 APN 1 194794383 missense probably damaging 1.00
IGL02226:Plxna2 APN 1 194644424 missense probably damaging 1.00
IGL02227:Plxna2 APN 1 194752089 missense probably damaging 1.00
IGL02415:Plxna2 APN 1 194643964 missense probably damaging 1.00
IGL02440:Plxna2 APN 1 194746150 missense probably benign 0.10
IGL02545:Plxna2 APN 1 194786690 unclassified probably benign
IGL02553:Plxna2 APN 1 194751438 missense probably benign 0.08
IGL02882:Plxna2 APN 1 194762570 missense probably damaging 1.00
IGL02946:Plxna2 APN 1 194749309 splice site probably benign
IGL03062:Plxna2 APN 1 194762550 missense possibly damaging 0.72
IGL03095:Plxna2 APN 1 194801127 missense probably damaging 1.00
IGL03293:Plxna2 APN 1 194804945 missense probably damaging 0.99
G1Funyon:Plxna2 UTSW 1 194790175 missense probably benign 0.01
PIT4514001:Plxna2 UTSW 1 194794937 missense probably benign 0.00
R0024:Plxna2 UTSW 1 194643995 missense possibly damaging 0.57
R0040:Plxna2 UTSW 1 194643896 missense probably benign 0.13
R0040:Plxna2 UTSW 1 194643896 missense probably benign 0.13
R0063:Plxna2 UTSW 1 194644939 missense probably benign 0.00
R0063:Plxna2 UTSW 1 194644939 missense probably benign 0.00
R0217:Plxna2 UTSW 1 194644598 missense probably damaging 1.00
R0316:Plxna2 UTSW 1 194644150 missense probably damaging 1.00
R0440:Plxna2 UTSW 1 194644404 nonsense probably null
R0505:Plxna2 UTSW 1 194644348 missense possibly damaging 0.93
R0568:Plxna2 UTSW 1 194751386 missense probably benign 0.00
R0669:Plxna2 UTSW 1 194788837 missense probably damaging 0.99
R0674:Plxna2 UTSW 1 194649475 missense probably benign 0.00
R0885:Plxna2 UTSW 1 194644556 missense probably benign
R0898:Plxna2 UTSW 1 194797024 missense probably damaging 1.00
R0940:Plxna2 UTSW 1 194800555 missense probably benign 0.01
R1061:Plxna2 UTSW 1 194644093 missense probably damaging 1.00
R1067:Plxna2 UTSW 1 194780510 splice site probably null
R1222:Plxna2 UTSW 1 194800649 missense probably damaging 1.00
R1345:Plxna2 UTSW 1 194644486 missense probably damaging 1.00
R1363:Plxna2 UTSW 1 194804939 nonsense probably null
R1432:Plxna2 UTSW 1 194767463 missense probably benign 0.10
R1434:Plxna2 UTSW 1 194751540 splice site probably benign
R1597:Plxna2 UTSW 1 194749306 splice site probably benign
R1719:Plxna2 UTSW 1 194644370 missense possibly damaging 0.93
R1778:Plxna2 UTSW 1 194810970 missense probably benign 0.01
R1795:Plxna2 UTSW 1 194806303 missense probably damaging 0.99
R1819:Plxna2 UTSW 1 194790186 missense probably benign 0.03
R1926:Plxna2 UTSW 1 194762450 missense probably benign 0.02
R1966:Plxna2 UTSW 1 194644700 missense possibly damaging 0.91
R1987:Plxna2 UTSW 1 194643989 missense probably damaging 1.00
R1988:Plxna2 UTSW 1 194643989 missense probably damaging 1.00
R2034:Plxna2 UTSW 1 194780594 missense probably benign 0.00
R2131:Plxna2 UTSW 1 194644750 missense probably benign 0.01
R2171:Plxna2 UTSW 1 194800617 missense probably damaging 1.00
R2217:Plxna2 UTSW 1 194797748 missense probably damaging 1.00
R2311:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2340:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2342:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2423:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2424:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2425:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2842:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R2971:Plxna2 UTSW 1 194797731 missense probably damaging 1.00
R3236:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R3731:Plxna2 UTSW 1 194788885 missense probably benign 0.42
R3783:Plxna2 UTSW 1 194807521 missense probably damaging 1.00
R3784:Plxna2 UTSW 1 194644617 missense probably benign
R3787:Plxna2 UTSW 1 194643934 missense probably benign 0.10
R3845:Plxna2 UTSW 1 194793790 missense probably damaging 0.96
R3927:Plxna2 UTSW 1 194746157 missense probably benign 0.02
R3930:Plxna2 UTSW 1 194794910 missense probably benign 0.17
R3964:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R3980:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4067:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4120:Plxna2 UTSW 1 194780627 missense probably damaging 1.00
R4231:Plxna2 UTSW 1 194644454 missense probably damaging 1.00
R4257:Plxna2 UTSW 1 194644775 missense probably damaging 1.00
R4396:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4397:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4418:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4444:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4446:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4482:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4487:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4489:Plxna2 UTSW 1 194749317 missense probably damaging 1.00
R4571:Plxna2 UTSW 1 194810988 missense possibly damaging 0.91
R4622:Plxna2 UTSW 1 194812150 missense probably benign
R4623:Plxna2 UTSW 1 194812150 missense probably benign
R4684:Plxna2 UTSW 1 194762594 missense probably benign 0.42
R4688:Plxna2 UTSW 1 194644445 missense probably damaging 1.00
R4855:Plxna2 UTSW 1 194797732 missense probably benign 0.39
R4876:Plxna2 UTSW 1 194643775 missense probably benign 0.02
R5161:Plxna2 UTSW 1 194751404 missense probably benign
R5207:Plxna2 UTSW 1 194788899 missense probably benign 0.19
R5479:Plxna2 UTSW 1 194793873 missense probably benign
R5931:Plxna2 UTSW 1 194810870 missense probably damaging 1.00
R6026:Plxna2 UTSW 1 194799814 missense probably damaging 1.00
R6029:Plxna2 UTSW 1 194794427 missense probably benign 0.00
R6029:Plxna2 UTSW 1 194799575 missense probably damaging 1.00
R6059:Plxna2 UTSW 1 194810971 missense possibly damaging 0.79
R6238:Plxna2 UTSW 1 194790196 missense probably benign 0.01
R6322:Plxna2 UTSW 1 194754367 missense possibly damaging 0.89
R6668:Plxna2 UTSW 1 194810088 missense possibly damaging 0.68
R6709:Plxna2 UTSW 1 194789766 missense probably benign 0.01
R6748:Plxna2 UTSW 1 194794182 splice site probably null
R6838:Plxna2 UTSW 1 194804914 missense possibly damaging 0.90
R6844:Plxna2 UTSW 1 194793828 missense probably benign 0.08
R7069:Plxna2 UTSW 1 194793904 missense possibly damaging 0.51
R7122:Plxna2 UTSW 1 194644568 nonsense probably null
R7145:Plxna2 UTSW 1 194649522 missense probably benign 0.31
R7189:Plxna2 UTSW 1 194801058 missense possibly damaging 0.58
R7207:Plxna2 UTSW 1 194644019 missense probably damaging 1.00
R7232:Plxna2 UTSW 1 194712260 missense probably damaging 1.00
R7234:Plxna2 UTSW 1 194806390 missense probably damaging 0.96
R7246:Plxna2 UTSW 1 194644282 missense possibly damaging 0.74
R7255:Plxna2 UTSW 1 194752103 missense probably benign 0.03
R7283:Plxna2 UTSW 1 194644883 missense probably damaging 0.99
R7361:Plxna2 UTSW 1 194799779 missense probably damaging 1.00
R7424:Plxna2 UTSW 1 194806339 missense probably damaging 0.98
R7501:Plxna2 UTSW 1 194643895 missense possibly damaging 0.95
R7528:Plxna2 UTSW 1 194812156 missense probably damaging 1.00
R7529:Plxna2 UTSW 1 194643871 missense probably benign 0.25
R7532:Plxna2 UTSW 1 194644819 missense probably benign 0.13
R7959:Plxna2 UTSW 1 194793864 frame shift probably null
R7959:Plxna2 UTSW 1 194810962 missense probably damaging 1.00
R7960:Plxna2 UTSW 1 194793864 frame shift probably null
R8261:Plxna2 UTSW 1 194749416 missense probably damaging 1.00
R8301:Plxna2 UTSW 1 194790175 missense probably benign 0.01
R8463:Plxna2 UTSW 1 194644046 missense probably damaging 1.00
R8519:Plxna2 UTSW 1 194793958 missense probably damaging 1.00
R8836:Plxna2 UTSW 1 194796935 missense possibly damaging 0.94
R9010:Plxna2 UTSW 1 194788909 missense possibly damaging 0.95
R9034:Plxna2 UTSW 1 194793889 missense probably damaging 1.00
R9254:Plxna2 UTSW 1 194810166 missense probably damaging 1.00
R9274:Plxna2 UTSW 1 194788828 missense probably damaging 1.00
R9379:Plxna2 UTSW 1 194810166 missense probably damaging 1.00
R9385:Plxna2 UTSW 1 194749416 missense possibly damaging 0.95
R9422:Plxna2 UTSW 1 194644422 missense probably damaging 1.00
R9451:Plxna2 UTSW 1 194644384 missense probably benign 0.05
R9484:Plxna2 UTSW 1 194644894 missense probably damaging 1.00
X0027:Plxna2 UTSW 1 194644433 missense probably damaging 1.00
Z1088:Plxna2 UTSW 1 194644441 missense possibly damaging 0.56
Z1088:Plxna2 UTSW 1 194764539 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CCACTTCTAATAGCTTCAAGTTGG -3'
(R):5'- TCTGGACTTCCTGGGAATCC -3'

Sequencing Primer
(F):5'- GTCCTATAGTAAACAACCTATGGCAG -3'
(R):5'- TGGGAATCCCTGGCCTACATC -3'
Posted On 2019-06-26