Incidental Mutation 'R7288:Mettl8'
ID566137
Institutional Source Beutler Lab
Gene Symbol Mettl8
Ensembl Gene ENSMUSG00000041975
Gene Namemethyltransferase like 8
SynonymsTIP
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.821) question?
Stock #R7288 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location70964561-71055583 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 70982038 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 84 (D84E)
Ref Sequence ENSEMBL: ENSMUSP00000097615 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090849] [ENSMUST00000100037] [ENSMUST00000112179] [ENSMUST00000112186] [ENSMUST00000121586] [ENSMUST00000148876] [ENSMUST00000149181]
Predicted Effect probably benign
Transcript: ENSMUST00000090849
Predicted Effect probably benign
Transcript: ENSMUST00000100037
AA Change: D84E

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000097615
Gene: ENSMUSG00000041975
AA Change: D84E

DomainStartEndE-ValueType
Pfam:Methyltransf_23 115 304 1.4e-14 PFAM
Pfam:Ubie_methyltran 126 265 1.4e-7 PFAM
Pfam:Methyltransf_31 137 304 5.6e-10 PFAM
Pfam:Methyltransf_26 140 251 4.2e-8 PFAM
Pfam:Methyltransf_25 143 246 5.3e-13 PFAM
Pfam:Methyltransf_12 144 248 1e-12 PFAM
Pfam:Methyltransf_11 144 250 7.4e-14 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000112179
AA Change: D131E

PolyPhen 2 Score 0.738 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000107800
Gene: ENSMUSG00000041975
AA Change: D131E

DomainStartEndE-ValueType
low complexity region 190 206 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000112186
AA Change: D131E

PolyPhen 2 Score 0.016 (Sensitivity: 0.95; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000107804
Gene: ENSMUSG00000041975
AA Change: D131E

DomainStartEndE-ValueType
Pfam:Methyltransf_23 158 349 5.1e-15 PFAM
Pfam:Ubie_methyltran 173 312 8.7e-8 PFAM
Pfam:Methyltransf_31 184 348 3.7e-9 PFAM
Pfam:Methyltransf_25 190 293 3.9e-13 PFAM
Pfam:Methyltransf_12 191 295 7e-13 PFAM
Pfam:Methyltransf_11 191 297 6.2e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000121586
AA Change: D131E

PolyPhen 2 Score 0.061 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000113642
Gene: ENSMUSG00000041975
AA Change: D131E

DomainStartEndE-ValueType
Pfam:Methyltransf_25 190 279 1.4e-6 PFAM
Pfam:Methyltransf_11 191 280 5.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000148876
AA Change: D131E

PolyPhen 2 Score 0.036 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000115855
Gene: ENSMUSG00000041975
AA Change: D131E

DomainStartEndE-ValueType
Pfam:Methyltransf_25 190 281 1.9e-8 PFAM
Pfam:Methyltransf_11 191 280 2.8e-8 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000149181
AA Change: D49E

PolyPhen 2 Score 0.910 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000119863
Gene: ENSMUSG00000041975
AA Change: D49E

DomainStartEndE-ValueType
SCOP:d1af7_2 107 137 7e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: This locus encodes a member of the methyltransferase family, and is involved in chromatin remodeling. Transcripts from this locus can be induced or inhibited by cell stretch and affect cell differentiation in the myogenic or adipogenic pathways. Multiple transcript variants encoding different isoforms have been found for this gene. Additional splice variants have been described in the literature but they meet nonsense-mediated decay (NMD) criteria and are likely to be degraded as soon as they are transcribed. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced 3-methylcytidine (m3C) methyltransferases modification of mRNA. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T A 11: 58,880,305 D204E probably benign Het
Adh1 T G 3: 138,282,732 D155E probably benign Het
Akt1s1 T C 7: 44,849,147 L2P unknown Het
Ash1l T A 3: 88,965,892 probably benign Het
Bend7 C T 2: 4,752,830 P228S probably damaging Het
Bpifc T C 10: 85,988,721 E218G possibly damaging Het
Cdk6 T A 5: 3,429,001 F127Y probably benign Het
Cgnl1 A T 9: 71,725,564 H168Q possibly damaging Het
Chd7 C T 4: 8,847,093 T1612I possibly damaging Het
Col4a4 A T 1: 82,492,463 C782S unknown Het
Copg2 T A 6: 30,824,406 I364L probably damaging Het
Crygb A G 1: 65,081,925 L81P probably benign Het
Cyp4f18 A T 8: 71,993,173 M326K probably damaging Het
Dhx34 A G 7: 16,215,436 S356P probably benign Het
Dmbt1 C T 7: 131,083,789 Q855* probably null Het
Dnph1 A G 17: 46,499,012 N160S probably benign Het
Esrra A T 19: 6,912,771 C228* probably null Het
Evpl T C 11: 116,223,949 N972D probably benign Het
Fat3 T C 9: 15,998,592 D2038G probably damaging Het
Fhit T A 14: 9,763,784 R102W probably damaging Het
Gal3st1 A T 11: 3,998,609 D272V probably damaging Het
Gal3st1 T A 11: 3,998,651 V286D probably damaging Het
Gemin4 A T 11: 76,213,380 M185K possibly damaging Het
Hecw1 T C 13: 14,316,236 I311V probably benign Het
Ift172 T C 5: 31,285,286 Y179C probably damaging Het
Ighv7-3 C T 12: 114,153,343 W66* probably null Het
Iqgap3 T A 3: 88,108,835 I975N probably damaging Het
Khdrbs3 A G 15: 69,049,413 E281G possibly damaging Het
Lamb2 A T 9: 108,488,324 T1369S probably benign Het
Mrgprb3 C A 7: 48,643,311 C164F probably damaging Het
Mtg2 A G 2: 180,083,387 Y131C probably damaging Het
Nacc1 C T 8: 84,676,545 A234T probably benign Het
Nsmaf C T 4: 6,416,641 V551I probably benign Het
Olfr541 T A 7: 140,705,029 C259* probably null Het
Olfr869 T A 9: 20,137,441 Y108* probably null Het
Oxr1 C T 15: 41,813,608 P187L not run Het
Pcdhb12 T A 18: 37,436,015 D71E probably benign Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Pkm A G 9: 59,668,913 S127G probably benign Het
Plxna2 T A 1: 194,796,919 L1296H probably damaging Het
Ppil6 C G 10: 41,498,528 T135R probably benign Het
Ppp2r3a T C 9: 101,127,004 Y378C probably damaging Het
Rabep2 C T 7: 126,444,205 R426C probably damaging Het
Rad21 A T 15: 51,982,580 H31Q possibly damaging Het
Rad50 G T 11: 53,654,949 Y1182* probably null Het
Serpinb9c C T 13: 33,151,900 A218T possibly damaging Het
Slc17a2 C A 13: 23,819,112 H248Q probably benign Het
Slc45a4 C A 15: 73,586,936 E255* probably null Het
Slc8a3 T A 12: 81,216,824 K596N possibly damaging Het
Tbc1d32 A C 10: 56,051,387 probably null Het
Tbl2 T A 5: 135,154,399 I112N possibly damaging Het
Tchp A C 5: 114,715,569 K238T probably damaging Het
Tfap2d G A 1: 19,118,983 G251D probably damaging Het
Thrb T A 14: 18,030,186 M324K probably damaging Het
Tmem259 A T 10: 79,978,466 L328Q probably damaging Het
Tmtc2 T C 10: 105,413,608 H88R probably damaging Het
Tnfrsf21 A G 17: 43,037,818 H107R possibly damaging Het
Trib1 T C 15: 59,654,622 V347A probably benign Het
Ung T A 5: 114,131,254 L9* probably null Het
Vmn1r195 G T 13: 22,279,004 V215F probably damaging Het
Wdr63 T C 3: 146,081,252 T343A probably damaging Het
Wdr90 A G 17: 25,846,312 S1657P probably benign Het
Wdsub1 A T 2: 59,878,143 Y129N possibly damaging Het
Zfp369 T G 13: 65,285,018 probably null Het
Zfp770 G T 2: 114,195,661 C642* probably null Het
Zfp981 C T 4: 146,537,643 R342C probably benign Het
Zhx3 A C 2: 160,781,122 V375G probably damaging Het
Other mutations in Mettl8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00795:Mettl8 APN 2 70982090 missense probably damaging 1.00
IGL01370:Mettl8 APN 2 70982039 missense probably damaging 1.00
R1709:Mettl8 UTSW 2 70982151 missense probably benign 0.02
R1944:Mettl8 UTSW 2 70973279 missense probably damaging 1.00
R5107:Mettl8 UTSW 2 70965557 missense probably damaging 1.00
R5278:Mettl8 UTSW 2 70973297 missense probably damaging 1.00
R5629:Mettl8 UTSW 2 70965569 missense probably benign
R5864:Mettl8 UTSW 2 70982013 missense probably benign 0.10
R6272:Mettl8 UTSW 2 70976075 unclassified probably null
R6402:Mettl8 UTSW 2 70966461 nonsense probably null
R6535:Mettl8 UTSW 2 70973389 missense possibly damaging 0.73
R7181:Mettl8 UTSW 2 70973362 missense possibly damaging 0.79
R7409:Mettl8 UTSW 2 70973343 missense probably damaging 1.00
R7498:Mettl8 UTSW 2 70965625 missense probably damaging 0.98
R7639:Mettl8 UTSW 2 70982182 missense probably benign
R7789:Mettl8 UTSW 2 70966462 missense probably damaging 1.00
R7795:Mettl8 UTSW 2 70981899 missense probably benign
X0062:Mettl8 UTSW 2 70981974 missense probably benign 0.33
Predicted Primers PCR Primer
(F):5'- TTCGAAAAGTGGCATTGCTACC -3'
(R):5'- GTGTGCACCACAACACTTGAC -3'

Sequencing Primer
(F):5'- ACCAGGAAACGGCTCTGTCTTC -3'
(R):5'- GGGATATATTTTACCAGACCC -3'
Posted On2019-06-26