Incidental Mutation 'R7288:Zhx3'
ID566139
Institutional Source Beutler Lab
Gene Symbol Zhx3
Ensembl Gene ENSMUSG00000035877
Gene Namezinc fingers and homeoboxes 3
Synonyms9530010N21Rik, 4932418O04Rik, Tix1, 1810059C13Rik
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7288 (G1)
Quality Score225.009
Status Not validated
Chromosome2
Chromosomal Location160748708-160872998 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 160781122 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 375 (V375G)
Ref Sequence ENSEMBL: ENSMUSP00000099400 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103111] [ENSMUST00000103112] [ENSMUST00000109460] [ENSMUST00000127201] [ENSMUST00000176141]
Predicted Effect probably damaging
Transcript: ENSMUST00000103111
AA Change: V375G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099400
Gene: ENSMUSG00000035877
AA Change: V375G

DomainStartEndE-ValueType
low complexity region 42 58 N/A INTRINSIC
ZnF_C2H2 77 100 1.86e0 SMART
ZnF_C2H2 109 132 1.08e1 SMART
low complexity region 167 189 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
HOX 300 362 1.48e-6 SMART
low complexity region 434 447 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
HOX 489 551 2.25e-11 SMART
HOX 608 669 2.04e-9 SMART
low complexity region 677 690 N/A INTRINSIC
HOX 759 821 7.49e-8 SMART
Pfam:Homez 836 888 5.2e-26 PFAM
low complexity region 919 936 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000103112
AA Change: V375G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099401
Gene: ENSMUSG00000035877
AA Change: V375G

DomainStartEndE-ValueType
low complexity region 42 58 N/A INTRINSIC
ZnF_C2H2 77 100 1.86e0 SMART
ZnF_C2H2 109 132 1.08e1 SMART
low complexity region 167 189 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
HOX 300 362 1.48e-6 SMART
low complexity region 434 447 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
HOX 489 551 2.25e-11 SMART
HOX 608 669 2.04e-9 SMART
low complexity region 677 690 N/A INTRINSIC
HOX 759 821 7.49e-8 SMART
Pfam:Homez 836 888 5.2e-26 PFAM
low complexity region 919 936 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000109460
AA Change: V375G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000105086
Gene: ENSMUSG00000035877
AA Change: V375G

DomainStartEndE-ValueType
low complexity region 42 58 N/A INTRINSIC
ZnF_C2H2 77 100 1.86e0 SMART
ZnF_C2H2 109 132 1.08e1 SMART
low complexity region 167 189 N/A INTRINSIC
low complexity region 238 249 N/A INTRINSIC
HOX 300 362 1.48e-6 SMART
low complexity region 434 447 N/A INTRINSIC
low complexity region 457 473 N/A INTRINSIC
HOX 489 551 2.25e-11 SMART
HOX 608 669 2.04e-9 SMART
low complexity region 677 690 N/A INTRINSIC
HOX 759 821 7.49e-8 SMART
Pfam:Homez 841 888 1.3e-17 PFAM
low complexity region 919 936 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127201
SMART Domains Protein: ENSMUSP00000120488
Gene: ENSMUSG00000035877

DomainStartEndE-ValueType
low complexity region 42 58 N/A INTRINSIC
ZnF_C2H2 77 100 1.86e0 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000176141
SMART Domains Protein: ENSMUSP00000134763
Gene: ENSMUSG00000035877

DomainStartEndE-ValueType
low complexity region 42 58 N/A INTRINSIC
ZnF_C2H2 77 100 1.86e0 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the zinc fingers and homeoboxes (ZHX) gene family. The encoded protein contains two C2H2-type zinc fingers and five homeodomains and forms a dimer with itself or with zinc fingers and homeoboxes family member 1. In the nucleus, the dimerized protein interacts with the A subunit of the ubiquitous transcription factor nuclear factor-Y and may function as a transcriptional repressor. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T A 11: 58,880,305 D204E probably benign Het
Adh1 T G 3: 138,282,732 D155E probably benign Het
Akt1s1 T C 7: 44,849,147 L2P unknown Het
Ash1l T A 3: 88,965,892 probably benign Het
Bend7 C T 2: 4,752,830 P228S probably damaging Het
Bpifc T C 10: 85,988,721 E218G possibly damaging Het
Cdk6 T A 5: 3,429,001 F127Y probably benign Het
Cgnl1 A T 9: 71,725,564 H168Q possibly damaging Het
Chd7 C T 4: 8,847,093 T1612I possibly damaging Het
Col4a4 A T 1: 82,492,463 C782S unknown Het
Copg2 T A 6: 30,824,406 I364L probably damaging Het
Crygb A G 1: 65,081,925 L81P probably benign Het
Cyp4f18 A T 8: 71,993,173 M326K probably damaging Het
Dhx34 A G 7: 16,215,436 S356P probably benign Het
Dmbt1 C T 7: 131,083,789 Q855* probably null Het
Dnph1 A G 17: 46,499,012 N160S probably benign Het
Esrra A T 19: 6,912,771 C228* probably null Het
Evpl T C 11: 116,223,949 N972D probably benign Het
Fat3 T C 9: 15,998,592 D2038G probably damaging Het
Fhit T A 14: 9,763,784 R102W probably damaging Het
Gal3st1 A T 11: 3,998,609 D272V probably damaging Het
Gal3st1 T A 11: 3,998,651 V286D probably damaging Het
Gemin4 A T 11: 76,213,380 M185K possibly damaging Het
Hecw1 T C 13: 14,316,236 I311V probably benign Het
Ift172 T C 5: 31,285,286 Y179C probably damaging Het
Ighv7-3 C T 12: 114,153,343 W66* probably null Het
Iqgap3 T A 3: 88,108,835 I975N probably damaging Het
Khdrbs3 A G 15: 69,049,413 E281G possibly damaging Het
Lamb2 A T 9: 108,488,324 T1369S probably benign Het
Mettl8 A T 2: 70,982,038 D84E probably benign Het
Mrgprb3 C A 7: 48,643,311 C164F probably damaging Het
Mtg2 A G 2: 180,083,387 Y131C probably damaging Het
Nacc1 C T 8: 84,676,545 A234T probably benign Het
Nsmaf C T 4: 6,416,641 V551I probably benign Het
Olfr541 T A 7: 140,705,029 C259* probably null Het
Olfr869 T A 9: 20,137,441 Y108* probably null Het
Oxr1 C T 15: 41,813,608 P187L not run Het
Pcdhb12 T A 18: 37,436,015 D71E probably benign Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Pkm A G 9: 59,668,913 S127G probably benign Het
Plxna2 T A 1: 194,796,919 L1296H probably damaging Het
Ppil6 C G 10: 41,498,528 T135R probably benign Het
Ppp2r3a T C 9: 101,127,004 Y378C probably damaging Het
Rabep2 C T 7: 126,444,205 R426C probably damaging Het
Rad21 A T 15: 51,982,580 H31Q possibly damaging Het
Rad50 G T 11: 53,654,949 Y1182* probably null Het
Serpinb9c C T 13: 33,151,900 A218T possibly damaging Het
Slc17a2 C A 13: 23,819,112 H248Q probably benign Het
Slc45a4 C A 15: 73,586,936 E255* probably null Het
Slc8a3 T A 12: 81,216,824 K596N possibly damaging Het
Tbc1d32 A C 10: 56,051,387 probably null Het
Tbl2 T A 5: 135,154,399 I112N possibly damaging Het
Tchp A C 5: 114,715,569 K238T probably damaging Het
Tfap2d G A 1: 19,118,983 G251D probably damaging Het
Thrb T A 14: 18,030,186 M324K probably damaging Het
Tmem259 A T 10: 79,978,466 L328Q probably damaging Het
Tmtc2 T C 10: 105,413,608 H88R probably damaging Het
Tnfrsf21 A G 17: 43,037,818 H107R possibly damaging Het
Trib1 T C 15: 59,654,622 V347A probably benign Het
Ung T A 5: 114,131,254 L9* probably null Het
Vmn1r195 G T 13: 22,279,004 V215F probably damaging Het
Wdr63 T C 3: 146,081,252 T343A probably damaging Het
Wdr90 A G 17: 25,846,312 S1657P probably benign Het
Wdsub1 A T 2: 59,878,143 Y129N possibly damaging Het
Zfp369 T G 13: 65,285,018 probably null Het
Zfp770 G T 2: 114,195,661 C642* probably null Het
Zfp981 C T 4: 146,537,643 R342C probably benign Het
Other mutations in Zhx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00530:Zhx3 APN 2 160780841 missense probably damaging 0.99
IGL01759:Zhx3 APN 2 160780714 missense probably damaging 1.00
IGL02170:Zhx3 APN 2 160779798 missense probably damaging 1.00
IGL02550:Zhx3 APN 2 160781296 missense probably damaging 1.00
R0497:Zhx3 UTSW 2 160779994 nonsense probably null
R0882:Zhx3 UTSW 2 160780709 missense probably damaging 1.00
R1396:Zhx3 UTSW 2 160781020 missense possibly damaging 0.90
R1587:Zhx3 UTSW 2 160781693 unclassified probably null
R1646:Zhx3 UTSW 2 160781275 missense probably damaging 1.00
R1822:Zhx3 UTSW 2 160780355 missense probably benign 0.03
R2322:Zhx3 UTSW 2 160782028 missense probably damaging 1.00
R3791:Zhx3 UTSW 2 160780448 missense possibly damaging 0.94
R3899:Zhx3 UTSW 2 160780451 missense possibly damaging 0.82
R4003:Zhx3 UTSW 2 160780889 missense probably damaging 0.96
R4619:Zhx3 UTSW 2 160781959 missense probably damaging 0.96
R5307:Zhx3 UTSW 2 160779868 missense probably benign 0.02
R5461:Zhx3 UTSW 2 160780018 missense probably benign
R5648:Zhx3 UTSW 2 160781961 missense probably damaging 1.00
R5952:Zhx3 UTSW 2 160782017 missense probably damaging 1.00
R6035:Zhx3 UTSW 2 160779543 missense probably benign
R6035:Zhx3 UTSW 2 160779543 missense probably benign
R6734:Zhx3 UTSW 2 160781720 missense probably damaging 0.99
R6988:Zhx3 UTSW 2 160779868 missense probably benign 0.02
R7032:Zhx3 UTSW 2 160780978 missense probably damaging 1.00
R7348:Zhx3 UTSW 2 160782118 nonsense probably null
RF002:Zhx3 UTSW 2 160781806 missense probably damaging 0.98
Z1088:Zhx3 UTSW 2 160779755 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CAGATGCAGTTGTCAGAGGG -3'
(R):5'- GGACTCCAACAGCTTTCTGAAG -3'

Sequencing Primer
(F):5'- TGATGCTTGTAACCCATTGGC -3'
(R):5'- TCCAACAGCTTTCTGAAGAACTC -3'
Posted On2019-06-26