Incidental Mutation 'R7288:Pigt'
ID566140
Institutional Source Beutler Lab
Gene Symbol Pigt
Ensembl Gene ENSMUSG00000017721
Gene Namephosphatidylinositol glycan anchor biosynthesis, class T
Synonyms2510012P17Rik, 4930534E15Rik, NDAP, Ndap7, CGI-06
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.855) question?
Stock #R7288 (G1)
Quality Score214.458
Status Not validated
Chromosome2
Chromosomal Location164497520-164508301 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT to CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT at 164499669 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112577 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103101] [ENSMUST00000117066]
Predicted Effect probably null
Transcript: ENSMUST00000103101
SMART Domains Protein: ENSMUSP00000099390
Gene: ENSMUSG00000017721

DomainStartEndE-ValueType
Pfam:Gpi16 22 576 4.9e-155 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000117066
SMART Domains Protein: ENSMUSP00000112577
Gene: ENSMUSG00000017721

DomainStartEndE-ValueType
Pfam:Gpi16 11 419 4.9e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152522
SMART Domains Protein: ENSMUSP00000115362
Gene: ENSMUSG00000017721

DomainStartEndE-ValueType
Pfam:Gpi16 21 134 2.7e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is involved in glycosylphosphatidylinositol (GPI)-anchor biosynthesis. The GPI-anchor is a glycolipid found on many blood cells and serves to anchor proteins to the cell surface. This protein is an essential component of the multisubunit enzyme, GPI transamidase. GPI transamidase mediates GPI anchoring in the endoplasmic reticulum, by catalyzing the transfer of fully assembled GPI units to proteins. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Mice homozygous for a null mutation do not survive. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T A 11: 58,880,305 D204E probably benign Het
Adh1 T G 3: 138,282,732 D155E probably benign Het
Akt1s1 T C 7: 44,849,147 L2P unknown Het
Ash1l T A 3: 88,965,892 probably benign Het
Bend7 C T 2: 4,752,830 P228S probably damaging Het
Bpifc T C 10: 85,988,721 E218G possibly damaging Het
Cdk6 T A 5: 3,429,001 F127Y probably benign Het
Cgnl1 A T 9: 71,725,564 H168Q possibly damaging Het
Chd7 C T 4: 8,847,093 T1612I possibly damaging Het
Col4a4 A T 1: 82,492,463 C782S unknown Het
Copg2 T A 6: 30,824,406 I364L probably damaging Het
Crygb A G 1: 65,081,925 L81P probably benign Het
Cyp4f18 A T 8: 71,993,173 M326K probably damaging Het
Dhx34 A G 7: 16,215,436 S356P probably benign Het
Dmbt1 C T 7: 131,083,789 Q855* probably null Het
Dnph1 A G 17: 46,499,012 N160S probably benign Het
Esrra A T 19: 6,912,771 C228* probably null Het
Evpl T C 11: 116,223,949 N972D probably benign Het
Fat3 T C 9: 15,998,592 D2038G probably damaging Het
Fhit T A 14: 9,763,784 R102W probably damaging Het
Gal3st1 A T 11: 3,998,609 D272V probably damaging Het
Gal3st1 T A 11: 3,998,651 V286D probably damaging Het
Gemin4 A T 11: 76,213,380 M185K possibly damaging Het
Hecw1 T C 13: 14,316,236 I311V probably benign Het
Ift172 T C 5: 31,285,286 Y179C probably damaging Het
Ighv7-3 C T 12: 114,153,343 W66* probably null Het
Iqgap3 T A 3: 88,108,835 I975N probably damaging Het
Khdrbs3 A G 15: 69,049,413 E281G possibly damaging Het
Lamb2 A T 9: 108,488,324 T1369S probably benign Het
Mettl8 A T 2: 70,982,038 D84E probably benign Het
Mrgprb3 C A 7: 48,643,311 C164F probably damaging Het
Mtg2 A G 2: 180,083,387 Y131C probably damaging Het
Nacc1 C T 8: 84,676,545 A234T probably benign Het
Nsmaf C T 4: 6,416,641 V551I probably benign Het
Olfr541 T A 7: 140,705,029 C259* probably null Het
Olfr869 T A 9: 20,137,441 Y108* probably null Het
Oxr1 C T 15: 41,813,608 P187L not run Het
Pcdhb12 T A 18: 37,436,015 D71E probably benign Het
Pkm A G 9: 59,668,913 S127G probably benign Het
Plxna2 T A 1: 194,796,919 L1296H probably damaging Het
Ppil6 C G 10: 41,498,528 T135R probably benign Het
Ppp2r3a T C 9: 101,127,004 Y378C probably damaging Het
Rabep2 C T 7: 126,444,205 R426C probably damaging Het
Rad21 A T 15: 51,982,580 H31Q possibly damaging Het
Rad50 G T 11: 53,654,949 Y1182* probably null Het
Serpinb9c C T 13: 33,151,900 A218T possibly damaging Het
Slc17a2 C A 13: 23,819,112 H248Q probably benign Het
Slc45a4 C A 15: 73,586,936 E255* probably null Het
Slc8a3 T A 12: 81,216,824 K596N possibly damaging Het
Tbc1d32 A C 10: 56,051,387 probably null Het
Tbl2 T A 5: 135,154,399 I112N possibly damaging Het
Tchp A C 5: 114,715,569 K238T probably damaging Het
Tfap2d G A 1: 19,118,983 G251D probably damaging Het
Thrb T A 14: 18,030,186 M324K probably damaging Het
Tmem259 A T 10: 79,978,466 L328Q probably damaging Het
Tmtc2 T C 10: 105,413,608 H88R probably damaging Het
Tnfrsf21 A G 17: 43,037,818 H107R possibly damaging Het
Trib1 T C 15: 59,654,622 V347A probably benign Het
Ung T A 5: 114,131,254 L9* probably null Het
Vmn1r195 G T 13: 22,279,004 V215F probably damaging Het
Wdr63 T C 3: 146,081,252 T343A probably damaging Het
Wdr90 A G 17: 25,846,312 S1657P probably benign Het
Wdsub1 A T 2: 59,878,143 Y129N possibly damaging Het
Zfp369 T G 13: 65,285,018 probably null Het
Zfp770 G T 2: 114,195,661 C642* probably null Het
Zfp981 C T 4: 146,537,643 R342C probably benign Het
Zhx3 A C 2: 160,781,122 V375G probably damaging Het
Other mutations in Pigt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03076:Pigt APN 2 164497665 missense probably damaging 1.00
BB003:Pigt UTSW 2 164499669 frame shift probably null
R1548:Pigt UTSW 2 164501519 missense probably benign 0.37
R1551:Pigt UTSW 2 164507403 missense probably damaging 0.99
R1605:Pigt UTSW 2 164507499 missense probably damaging 1.00
R3712:Pigt UTSW 2 164501645 missense probably benign 0.00
R3848:Pigt UTSW 2 164498580 critical splice donor site probably benign
R4672:Pigt UTSW 2 164497578 unclassified probably benign
R4719:Pigt UTSW 2 164501624 missense probably damaging 0.98
R5481:Pigt UTSW 2 164506422 missense probably damaging 1.00
R5567:Pigt UTSW 2 164501562 nonsense probably null
R5570:Pigt UTSW 2 164501562 nonsense probably null
R5998:Pigt UTSW 2 164507454 missense possibly damaging 0.82
R6112:Pigt UTSW 2 164506445 nonsense probably null
R6816:Pigt UTSW 2 164501132 missense probably damaging 1.00
R6889:Pigt UTSW 2 164507331 missense probably damaging 1.00
R7019:Pigt UTSW 2 164499669 frame shift probably null
R7037:Pigt UTSW 2 164499669 frame shift probably null
R7197:Pigt UTSW 2 164502516 missense probably damaging 1.00
R7449:Pigt UTSW 2 164502499 missense probably damaging 1.00
R7822:Pigt UTSW 2 164499669 frame shift probably null
R8005:Pigt UTSW 2 164499669 frame shift probably null
R8019:Pigt UTSW 2 164499669 frame shift probably null
Predicted Primers PCR Primer
(F):5'- AGTGTTCCCAGGCAAGATGG -3'
(R):5'- ATGCACAGAAGATCCCCGAG -3'

Sequencing Primer
(F):5'- TTCCCAGGCAAGATGGACACTTG -3'
(R):5'- AGAGGACATTGCTGAGCTCC -3'
Posted On2019-06-26