Incidental Mutation 'R7288:Ift172'
ID566150
Institutional Source Beutler Lab
Gene Symbol Ift172
Ensembl Gene ENSMUSG00000038564
Gene Nameintraflagellar transport 172
Synonymswim
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7288 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location31253277-31291116 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 31285286 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Cysteine at position 179 (Y179C)
Ref Sequence ENSEMBL: ENSMUSP00000049335 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041565] [ENSMUST00000201809]
Predicted Effect probably damaging
Transcript: ENSMUST00000041565
AA Change: Y179C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000049335
Gene: ENSMUSG00000038564
AA Change: Y179C

DomainStartEndE-ValueType
WD40 2 44 6e-3 SMART
WD40 55 94 2.22e0 SMART
WD40 102 139 1.23e2 SMART
WD40 141 180 4.6e0 SMART
WD40 186 223 3.3e1 SMART
WD40 225 267 4.42e1 SMART
WD40 279 314 1.03e1 SMART
Blast:WD40 516 550 5e-13 BLAST
low complexity region 573 588 N/A INTRINSIC
internal_repeat_1 625 1026 1.7e-10 PROSPERO
Blast:TPR 1029 1062 2e-13 BLAST
low complexity region 1077 1091 N/A INTRINSIC
internal_repeat_1 1101 1498 1.7e-10 PROSPERO
Predicted Effect probably benign
Transcript: ENSMUST00000201809
SMART Domains Protein: ENSMUSP00000144425
Gene: ENSMUSG00000038564

DomainStartEndE-ValueType
WD40 2 44 3.8e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202589
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of the intraflagellar transport subcomplex IFT-B. Subcomplexes IFT-A and IFT-B are necessary for ciliary assembly and maintenance. Mutations in this gene have been associated with skeletal ciliopathies, with or without polydactyly, such as such short-rib thoracic dysplasias 1, 9 or 10. [provided by RefSeq, Mar 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene display embryonic lethality during organogenesis, neural tube defects, and developmental patterning abnormalities. Mice homozygous for a conditional allele activated in the early limb bud exhibit polydactyly and short limbs. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T A 11: 58,880,305 D204E probably benign Het
Adh1 T G 3: 138,282,732 D155E probably benign Het
Akt1s1 T C 7: 44,849,147 L2P unknown Het
Ash1l T A 3: 88,965,892 probably benign Het
Bend7 C T 2: 4,752,830 P228S probably damaging Het
Bpifc T C 10: 85,988,721 E218G possibly damaging Het
Cdk6 T A 5: 3,429,001 F127Y probably benign Het
Cgnl1 A T 9: 71,725,564 H168Q possibly damaging Het
Chd7 C T 4: 8,847,093 T1612I possibly damaging Het
Col4a4 A T 1: 82,492,463 C782S unknown Het
Copg2 T A 6: 30,824,406 I364L probably damaging Het
Crygb A G 1: 65,081,925 L81P probably benign Het
Cyp4f18 A T 8: 71,993,173 M326K probably damaging Het
Dhx34 A G 7: 16,215,436 S356P probably benign Het
Dmbt1 C T 7: 131,083,789 Q855* probably null Het
Dnph1 A G 17: 46,499,012 N160S probably benign Het
Esrra A T 19: 6,912,771 C228* probably null Het
Evpl T C 11: 116,223,949 N972D probably benign Het
Fat3 T C 9: 15,998,592 D2038G probably damaging Het
Fhit T A 14: 9,763,784 R102W probably damaging Het
Gal3st1 A T 11: 3,998,609 D272V probably damaging Het
Gal3st1 T A 11: 3,998,651 V286D probably damaging Het
Gemin4 A T 11: 76,213,380 M185K possibly damaging Het
Hecw1 T C 13: 14,316,236 I311V probably benign Het
Ighv7-3 C T 12: 114,153,343 W66* probably null Het
Iqgap3 T A 3: 88,108,835 I975N probably damaging Het
Khdrbs3 A G 15: 69,049,413 E281G possibly damaging Het
Lamb2 A T 9: 108,488,324 T1369S probably benign Het
Mettl8 A T 2: 70,982,038 D84E probably benign Het
Mrgprb3 C A 7: 48,643,311 C164F probably damaging Het
Mtg2 A G 2: 180,083,387 Y131C probably damaging Het
Nacc1 C T 8: 84,676,545 A234T probably benign Het
Nsmaf C T 4: 6,416,641 V551I probably benign Het
Olfr541 T A 7: 140,705,029 C259* probably null Het
Olfr869 T A 9: 20,137,441 Y108* probably null Het
Oxr1 C T 15: 41,813,608 P187L not run Het
Pcdhb12 T A 18: 37,436,015 D71E probably benign Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Pkm A G 9: 59,668,913 S127G probably benign Het
Plxna2 T A 1: 194,796,919 L1296H probably damaging Het
Ppil6 C G 10: 41,498,528 T135R probably benign Het
Ppp2r3a T C 9: 101,127,004 Y378C probably damaging Het
Rabep2 C T 7: 126,444,205 R426C probably damaging Het
Rad21 A T 15: 51,982,580 H31Q possibly damaging Het
Rad50 G T 11: 53,654,949 Y1182* probably null Het
Serpinb9c C T 13: 33,151,900 A218T possibly damaging Het
Slc17a2 C A 13: 23,819,112 H248Q probably benign Het
Slc45a4 C A 15: 73,586,936 E255* probably null Het
Slc8a3 T A 12: 81,216,824 K596N possibly damaging Het
Tbc1d32 A C 10: 56,051,387 probably null Het
Tbl2 T A 5: 135,154,399 I112N possibly damaging Het
Tchp A C 5: 114,715,569 K238T probably damaging Het
Tfap2d G A 1: 19,118,983 G251D probably damaging Het
Thrb T A 14: 18,030,186 M324K probably damaging Het
Tmem259 A T 10: 79,978,466 L328Q probably damaging Het
Tmtc2 T C 10: 105,413,608 H88R probably damaging Het
Tnfrsf21 A G 17: 43,037,818 H107R possibly damaging Het
Trib1 T C 15: 59,654,622 V347A probably benign Het
Ung T A 5: 114,131,254 L9* probably null Het
Vmn1r195 G T 13: 22,279,004 V215F probably damaging Het
Wdr63 T C 3: 146,081,252 T343A probably damaging Het
Wdr90 A G 17: 25,846,312 S1657P probably benign Het
Wdsub1 A T 2: 59,878,143 Y129N possibly damaging Het
Zfp369 T G 13: 65,285,018 probably null Het
Zfp770 G T 2: 114,195,661 C642* probably null Het
Zfp981 C T 4: 146,537,643 R342C probably benign Het
Zhx3 A C 2: 160,781,122 V375G probably damaging Het
Other mutations in Ift172
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00476:Ift172 APN 5 31275896 missense probably damaging 1.00
IGL01399:Ift172 APN 5 31266248 missense probably benign
IGL01405:Ift172 APN 5 31261852 nonsense probably null
IGL01562:Ift172 APN 5 31267247 missense probably damaging 0.97
IGL01758:Ift172 APN 5 31280714 missense probably benign
IGL01792:Ift172 APN 5 31276871 missense probably damaging 1.00
IGL01830:Ift172 APN 5 31285292 missense probably damaging 1.00
IGL01839:Ift172 APN 5 31266350 missense probably damaging 1.00
IGL02007:Ift172 APN 5 31286604 missense probably benign 0.17
IGL02172:Ift172 APN 5 31281337 splice site probably benign
IGL02190:Ift172 APN 5 31254458 missense possibly damaging 0.51
IGL02334:Ift172 APN 5 31283058 missense probably benign 0.00
IGL02486:Ift172 APN 5 31257583 missense probably damaging 1.00
IGL02517:Ift172 APN 5 31253648 unclassified probably null
IGL02571:Ift172 APN 5 31257891 missense probably damaging 1.00
IGL02626:Ift172 APN 5 31264496 missense probably benign
IGL03183:Ift172 APN 5 31272004 missense probably benign 0.06
IGL03277:Ift172 APN 5 31267298 missense possibly damaging 0.92
IGL03349:Ift172 APN 5 31284130 missense probably benign 0.05
pushback UTSW 5 31286945 missense probably damaging 1.00
P0042:Ift172 UTSW 5 31261455 missense probably benign 0.35
PIT4802001:Ift172 UTSW 5 31285266 missense probably benign 0.03
R0153:Ift172 UTSW 5 31260624 missense probably benign
R0328:Ift172 UTSW 5 31263851 nonsense probably null
R0357:Ift172 UTSW 5 31257900 missense possibly damaging 0.51
R0369:Ift172 UTSW 5 31253641 missense probably damaging 1.00
R0391:Ift172 UTSW 5 31286667 missense probably damaging 1.00
R0512:Ift172 UTSW 5 31285477 missense possibly damaging 0.92
R0546:Ift172 UTSW 5 31257601 missense probably benign 0.14
R0553:Ift172 UTSW 5 31275842 splice site probably benign
R0606:Ift172 UTSW 5 31254313 missense probably damaging 0.99
R0834:Ift172 UTSW 5 31257371 missense probably benign
R0973:Ift172 UTSW 5 31257918 unclassified probably benign
R0973:Ift172 UTSW 5 31265355 missense probably benign
R1189:Ift172 UTSW 5 31285830 critical splice acceptor site probably null
R1205:Ift172 UTSW 5 31285792 missense probably benign
R1289:Ift172 UTSW 5 31280976 missense probably damaging 0.98
R1342:Ift172 UTSW 5 31261866 missense probably benign
R1395:Ift172 UTSW 5 31285238 unclassified probably benign
R1417:Ift172 UTSW 5 31256649 missense probably damaging 1.00
R2020:Ift172 UTSW 5 31267241 nonsense probably null
R2111:Ift172 UTSW 5 31286079 missense probably benign 0.04
R2175:Ift172 UTSW 5 31266685 missense probably damaging 1.00
R2509:Ift172 UTSW 5 31262968 missense probably benign
R2870:Ift172 UTSW 5 31257861 missense probably benign 0.00
R2870:Ift172 UTSW 5 31257861 missense probably benign 0.00
R2871:Ift172 UTSW 5 31257861 missense probably benign 0.00
R2871:Ift172 UTSW 5 31257861 missense probably benign 0.00
R2872:Ift172 UTSW 5 31257861 missense probably benign 0.00
R2872:Ift172 UTSW 5 31257861 missense probably benign 0.00
R3705:Ift172 UTSW 5 31261437 critical splice donor site probably null
R3793:Ift172 UTSW 5 31257581 missense possibly damaging 0.61
R4385:Ift172 UTSW 5 31286967 missense probably damaging 1.00
R4477:Ift172 UTSW 5 31265437 missense probably benign 0.38
R4590:Ift172 UTSW 5 31253955 missense probably damaging 1.00
R4663:Ift172 UTSW 5 31284215 missense probably benign 0.01
R4665:Ift172 UTSW 5 31285254 missense possibly damaging 0.82
R4977:Ift172 UTSW 5 31272116 missense possibly damaging 0.79
R5109:Ift172 UTSW 5 31265986 missense probably benign 0.06
R5182:Ift172 UTSW 5 31267614 missense possibly damaging 0.51
R5343:Ift172 UTSW 5 31263812 missense probably benign 0.05
R5465:Ift172 UTSW 5 31261518 splice site probably null
R5622:Ift172 UTSW 5 31283082 missense probably damaging 1.00
R5718:Ift172 UTSW 5 31255277 missense possibly damaging 0.94
R5793:Ift172 UTSW 5 31276948 missense possibly damaging 0.96
R5870:Ift172 UTSW 5 31276940 missense probably benign 0.10
R5919:Ift172 UTSW 5 31260662 missense possibly damaging 0.63
R5968:Ift172 UTSW 5 31261484 missense probably damaging 1.00
R6112:Ift172 UTSW 5 31256897 missense probably benign
R6339:Ift172 UTSW 5 31256583 missense probably benign 0.00
R6339:Ift172 UTSW 5 31286945 missense probably damaging 1.00
R6355:Ift172 UTSW 5 31284157 missense probably benign 0.33
R6565:Ift172 UTSW 5 31275883 missense possibly damaging 0.68
R6668:Ift172 UTSW 5 31255339 missense probably benign 0.00
R6755:Ift172 UTSW 5 31260998 nonsense probably null
R6818:Ift172 UTSW 5 31265960 missense probably benign 0.01
R6939:Ift172 UTSW 5 31257586 missense probably damaging 1.00
R6980:Ift172 UTSW 5 31257386 missense probably benign
R7047:Ift172 UTSW 5 31275894 nonsense probably null
R7156:Ift172 UTSW 5 31272075 missense probably damaging 1.00
R7180:Ift172 UTSW 5 31254262 missense probably damaging 1.00
R7351:Ift172 UTSW 5 31275896 missense probably damaging 1.00
R7706:Ift172 UTSW 5 31266379 nonsense probably null
X0022:Ift172 UTSW 5 31285320 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AAATGCATCTCTGTGGTGGCATC -3'
(R):5'- AGAGTCTTACGTGGTAGCACTG -3'

Sequencing Primer
(F):5'- TCTGTGGTGGCATCCAAAC -3'
(R):5'- GTCTTACGTGGTAGCACTGACAAC -3'
Posted On2019-06-26