Incidental Mutation 'R7288:Ung'
ID566151
Institutional Source Beutler Lab
Gene Symbol Ung
Ensembl Gene ENSMUSG00000029591
Gene Nameuracil DNA glycosylase
SynonymsUNG1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.922) question?
Stock #R7288 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location114130386-114139323 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 114131254 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 9 (L9*)
Ref Sequence ENSEMBL: ENSMUSP00000099644 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031587] [ENSMUST00000053657] [ENSMUST00000102584] [ENSMUST00000112275] [ENSMUST00000112279] [ENSMUST00000137402] [ENSMUST00000143455] [ENSMUST00000149418]
Predicted Effect probably benign
Transcript: ENSMUST00000031587
SMART Domains Protein: ENSMUSP00000031587
Gene: ENSMUSG00000029591

DomainStartEndE-ValueType
low complexity region 72 81 N/A INTRINSIC
UDG 132 293 5.86e-35 SMART
UreE_C 132 293 5.86e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000053657
SMART Domains Protein: ENSMUSP00000056043
Gene: ENSMUSG00000044339

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
Pfam:2OG-FeII_Oxy_2 47 232 1.9e-30 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000102584
AA Change: L9*
SMART Domains Protein: ENSMUSP00000099644
Gene: ENSMUSG00000029591
AA Change: L9*

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 61 70 N/A INTRINSIC
UDG 121 282 5.86e-35 SMART
UreE_C 121 282 5.86e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112275
SMART Domains Protein: ENSMUSP00000107894
Gene: ENSMUSG00000029591

DomainStartEndE-ValueType
UDG 25 186 5.86e-35 SMART
UreE_C 25 186 5.86e-35 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000112279
SMART Domains Protein: ENSMUSP00000107898
Gene: ENSMUSG00000044339

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
Pfam:2OG-FeII_Oxy_2 47 232 5.4e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000137402
SMART Domains Protein: ENSMUSP00000114140
Gene: ENSMUSG00000029591

DomainStartEndE-ValueType
UDG 35 184 2.05e-25 SMART
UreE_C 35 184 2.05e-25 SMART
Predicted Effect probably null
Transcript: ENSMUST00000143455
AA Change: L9*
SMART Domains Protein: ENSMUSP00000142484
Gene: ENSMUSG00000029591
AA Change: L9*

DomainStartEndE-ValueType
low complexity region 4 20 N/A INTRINSIC
low complexity region 61 70 N/A INTRINSIC
PDB:2SSP|E 76 127 3e-27 PDB
SCOP:d3euga_ 79 127 1e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149418
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 100.0%
  • 10x: 99.7%
  • 20x: 99.2%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of several uracil-DNA glycosylases. One important function of uracil-DNA glycosylases is to prevent mutagenesis by eliminating uracil from DNA molecules by cleaving the N-glycosylic bond and initiating the base-excision repair (BER) pathway. Uracil bases occur from cytosine deamination or misincorporation of dUMP residues. Alternative promoter usage and splicing of this gene leads to two different isoforms: the mitochondrial UNG1 and the nuclear UNG2. The UNG2 term was used as a previous symbol for the CCNO gene (GeneID 10309), which has been confused with this gene, in the literature and some databases. [provided by RefSeq, Nov 2010]
PHENOTYPE: Homozygous null mutants incorporate an elevated level of uracil into DNA of dividing cells. In hypermutation at immunoglobulin genes, mutations at C/G pairs are shifted toward transitions, and class-switch recombination is reduced. Homozygous null mutants display increased ischemic brain injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik T A 11: 58,880,305 D204E probably benign Het
Adh1 T G 3: 138,282,732 D155E probably benign Het
Akt1s1 T C 7: 44,849,147 L2P unknown Het
Ash1l T A 3: 88,965,892 probably benign Het
Bend7 C T 2: 4,752,830 P228S probably damaging Het
Bpifc T C 10: 85,988,721 E218G possibly damaging Het
Cdk6 T A 5: 3,429,001 F127Y probably benign Het
Cgnl1 A T 9: 71,725,564 H168Q possibly damaging Het
Chd7 C T 4: 8,847,093 T1612I possibly damaging Het
Col4a4 A T 1: 82,492,463 C782S unknown Het
Copg2 T A 6: 30,824,406 I364L probably damaging Het
Crygb A G 1: 65,081,925 L81P probably benign Het
Cyp4f18 A T 8: 71,993,173 M326K probably damaging Het
Dhx34 A G 7: 16,215,436 S356P probably benign Het
Dmbt1 C T 7: 131,083,789 Q855* probably null Het
Dnph1 A G 17: 46,499,012 N160S probably benign Het
Esrra A T 19: 6,912,771 C228* probably null Het
Evpl T C 11: 116,223,949 N972D probably benign Het
Fat3 T C 9: 15,998,592 D2038G probably damaging Het
Fhit T A 14: 9,763,784 R102W probably damaging Het
Gal3st1 A T 11: 3,998,609 D272V probably damaging Het
Gal3st1 T A 11: 3,998,651 V286D probably damaging Het
Gemin4 A T 11: 76,213,380 M185K possibly damaging Het
Hecw1 T C 13: 14,316,236 I311V probably benign Het
Ift172 T C 5: 31,285,286 Y179C probably damaging Het
Ighv7-3 C T 12: 114,153,343 W66* probably null Het
Iqgap3 T A 3: 88,108,835 I975N probably damaging Het
Khdrbs3 A G 15: 69,049,413 E281G possibly damaging Het
Lamb2 A T 9: 108,488,324 T1369S probably benign Het
Mettl8 A T 2: 70,982,038 D84E probably benign Het
Mrgprb3 C A 7: 48,643,311 C164F probably damaging Het
Mtg2 A G 2: 180,083,387 Y131C probably damaging Het
Nacc1 C T 8: 84,676,545 A234T probably benign Het
Nsmaf C T 4: 6,416,641 V551I probably benign Het
Olfr541 T A 7: 140,705,029 C259* probably null Het
Olfr869 T A 9: 20,137,441 Y108* probably null Het
Oxr1 C T 15: 41,813,608 P187L not run Het
Pcdhb12 T A 18: 37,436,015 D71E probably benign Het
Pigt CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT CCAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGATCTGTAACCACAGGCCAGTGAGTAGGTTTGTCTCTGTCTAGTGTGGAT 2: 164,499,669 probably null Het
Pkm A G 9: 59,668,913 S127G probably benign Het
Plxna2 T A 1: 194,796,919 L1296H probably damaging Het
Ppil6 C G 10: 41,498,528 T135R probably benign Het
Ppp2r3a T C 9: 101,127,004 Y378C probably damaging Het
Rabep2 C T 7: 126,444,205 R426C probably damaging Het
Rad21 A T 15: 51,982,580 H31Q possibly damaging Het
Rad50 G T 11: 53,654,949 Y1182* probably null Het
Serpinb9c C T 13: 33,151,900 A218T possibly damaging Het
Slc17a2 C A 13: 23,819,112 H248Q probably benign Het
Slc45a4 C A 15: 73,586,936 E255* probably null Het
Slc8a3 T A 12: 81,216,824 K596N possibly damaging Het
Tbc1d32 A C 10: 56,051,387 probably null Het
Tbl2 T A 5: 135,154,399 I112N possibly damaging Het
Tchp A C 5: 114,715,569 K238T probably damaging Het
Tfap2d G A 1: 19,118,983 G251D probably damaging Het
Thrb T A 14: 18,030,186 M324K probably damaging Het
Tmem259 A T 10: 79,978,466 L328Q probably damaging Het
Tmtc2 T C 10: 105,413,608 H88R probably damaging Het
Tnfrsf21 A G 17: 43,037,818 H107R possibly damaging Het
Trib1 T C 15: 59,654,622 V347A probably benign Het
Vmn1r195 G T 13: 22,279,004 V215F probably damaging Het
Wdr63 T C 3: 146,081,252 T343A probably damaging Het
Wdr90 A G 17: 25,846,312 S1657P probably benign Het
Wdsub1 A T 2: 59,878,143 Y129N possibly damaging Het
Zfp369 T G 13: 65,285,018 probably null Het
Zfp770 G T 2: 114,195,661 C642* probably null Het
Zfp981 C T 4: 146,537,643 R342C probably benign Het
Zhx3 A C 2: 160,781,122 V375G probably damaging Het
Other mutations in Ung
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01583:Ung APN 5 114137308 missense possibly damaging 0.50
IGL01995:Ung APN 5 114136386 missense probably benign 0.30
IGL02084:Ung APN 5 114130576 missense probably benign 0.00
R1219:Ung UTSW 5 114132167 unclassified probably benign
R1617:Ung UTSW 5 114131354 missense probably benign 0.14
R2513:Ung UTSW 5 114137192 missense probably benign 0.11
R4078:Ung UTSW 5 114130623 unclassified probably null
R4079:Ung UTSW 5 114130623 unclassified probably null
R6210:Ung UTSW 5 114131377 missense probably benign 0.15
R6258:Ung UTSW 5 114137300 missense probably benign 0.12
R6954:Ung UTSW 5 114131337 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- CCTCAGAGTCAATCGGTGTG -3'
(R):5'- TCGTTGTCAAGTGTGGCACG -3'

Sequencing Primer
(F):5'- GCCCTTGTATAGTCCAATC -3'
(R):5'- TTCCAGCTCTCGCCGAAG -3'
Posted On2019-06-26